Ch. 9.7 Mutations Every once in a while, cells make mistakes in copying their own DNA An incorrect base can be inserted or sometimes a base is skipped as the new DNA is being assembled Mutation : changes in DNA sequence that affect genetic information

Mistakes in DNA Chromosomal mutations: involve changes in whole chromosome – occur usually during meiosis (forming of gametes) Gene mutations: result from changes in a single gene

Gene Mutations Two types: 1) Point 2) Framshift * Point mutation : a. affect one nucleotide b. occur at a single point in the DNA sequence c. often one nucleotide is substituted for another d. generally change just one amino acid e. usually not lethal

Point Mutation Point mutations can change one of the amino acids (see below). This could affect the function of the protein. The location of the substitution can affect the severity of the mutation. For example: DNA: GCT mRNA: CGA Amino acid : Arginine Changing the 3 rd base in the codon did not change the amino acid; therefore, the protein is NOT affected. Now change: DNA: GCC mRNA: CGG Amino acid: Arginine

Point Mutation The location of the substitution can affect the severity of the mutation. Changing the 2 nd base in the codon DID change the amino acid; therefore, the protein is will be affected.

Beta hemoglobin (beta globin) is a single chain of 147 amino acids. In sickle-cell anemia, the gene for beta globin is mutated. The resulting protein still consists of 147 amino acids, but because of the single-base mutation, the sixth amino acid in the chain is valine, rather than glutamic acid. This substitution is depicted in Table above TACCAAGTAGGATGGGGGCTC TTCTCGCGGCACTGT StartValHisLeuThrProGlu LysSerAlaValThr TACCAAGTAGGATGGGGGCACCTCTTCTCGCGGCACTGT StartValHisLeuThrProValGluLysSerAlaValThr Normal Hemoglobin Mutant (Sickle-Cell) Hemoglobin Example of a point mutation: one nitrogen base is substituted

Frameshift Mutations Frameshift mutation- results from the insertion or deletion of a nucleotide A. Since the genetic code is read in groups of three, adding or deleting a nucleotide shifts all resulting amino acids B. This can alter a protein so much that it is unable to perform its normal functions C. Most likely lethal

Frameshift Mutation This is a MISSENSE mutation. The amino acid sequence has changed so the protein will most likely NOT function correctly.

Frameshift Mutation AUGCCCGAUGUGAAAAGGCACUAA StartProAspValLysArgHisStop AUGCCCGAUUGAAAAGGCACUAA Remove the FIRST G in the 4 th codon. The reading frame now shifts LEFT to make new codons. StartProAspSTOP This is a NONSENSE mutation. The reading frame shifted so the protein can NOT get made. This could be lethal.

Frameshift Mutation Frameshift mutation has also been one of the possible causes of albinism. A shift in the reading frame can lead to formation of stop codon, hence, early terminating protein translation. An early termination of any of the enzymes necessary for the production of melanin can result in albinism.albinismshiftstop codonproteintranslationtermination enzymesmelaninalbinism Tay Sachs disease is an example of a disease caused by frameshift mutation. The disease is caused by various mutations, including frameshift mutations, on chromosome 15 in the HEXA gene that codes for the alpha-subunit of the lysosomal enzyme beta-N- acetylhexosaminidase A. Tay Sachs diseasedisease mutationdiseasemutationschromosomegenecodesalphasubunitenzyme