From DNA to Protein

Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein. Most structures are a combination of protein and minerals.

Proteins consist of long chains of Amino Acids. DNA contains the code for making proteins. Each gene segment on the DNA codes for a single protein.

RNA RNA like DNA is a nucleic acid. RNA is different in 3 ways.

Way 1 RNA is single stranded. DNA is double stranded.

WAY 2 RNA contains the sugar RIBOSE. DNA contains the sugar DEOXYRIBOSE.

WAY 3 RNA contains 4 nitrogen bases but instead of Thymine RNA has Uracil. DNA has 4 nitrogen bases but no uracil.

DNA = Engineer RNA = Worker DNA ‘tells’ RNA how to built proteins. RNA builds proteins according to instructions from DNA.

3 Kinds of RNA Messenger RNA (mRNA) Brings information from the DNA in the nucleus to the cells cytoplasm.

Ribosomal RNA (rRNA) Clamp onto the mRNA and use its information to assemble the amino acids. SITE OF PROTEIN SYNTHESIS!!!

Transfer RNA (tRNA) Is the supplier. tRNA transports amino acids to the ribosome to be assembled into a protein.

Transcription When a protein needs to be made, a section of DNA unzips and mRNA attaches to the exposed bases on the DNA strand.

This produces a single strand of mRNA that is carrying the code from DNA for the protein.

The Genetic Code The nucleotide sequence transcribed from DNA to a strand of mRNA acts as a genetic message, the complete information for the building of a protein.

A group of three nucleotides codes for an amino acid. Each set of three nitrogen bases in mRNA representing an AA is known as a codon.

See table 11.2 page 298

Translation Once the mRNA has copied the genetic code from DNA it leaves the nucleus and goes into the cytoplasm. Here it links up with rRNA –(A RIBOSOME)

rRNA attaches to mRNA tRNA (carrying an AA) with the proper anticodon hooks to the codon found on the mRNA at the ribosome.

rRNA slides down mRNA one codon Another tRNA with the proper anticodon attaches to mRNA at the ribosome.

Within the ribosome the two AA on the ends of the two tRNAs’ are chemically bonded together. The ribosome slides down mRNA one codon.

This process continues until all the mRNA is read and all the AA are connected. Once the AA are bonded you have a complete protein. Read fig for greater detail.

Mini Lab 11.1 page 299. Sec Assessment 11.2 page 301.

Mutations When the DNA in a cell is changed it no longer produces the correct proteins. Any change in the DNA is called a mutation.

Mutations in reproductive cells These mutations are passed onto the offspring. The mutation may produce a new trait or result in a protein that does not work.

Mutations in Body Cells These mutations are NOT passed onto the offspring. They cause problems for the individual.

Once a cells DNA has changed every time the cell divides the new cell will have the same mutation.

When the mutation of DNA in body cells affect genes that control cell division the resulting cells grow and divide rapidly, producing the disease called cancer.

Ultraviolet Radiation The sun contains UV rays that cause the DNA in skin cells to mutate. The result is skin cancer.

Point Mutations A change in a single base pair in DNA. THE DOG BIT THE CAT. THE DOG BIT THE CAR.

DNA, 1st normal, 2nd point mutation. TACTTCAAACCGCGTAACATT TACTTCAAATCGCGTAACATT

FRAMESHIFT MUTATION When a single base is lost from a DNA strand resulting in a new sequence of nitrogen bases. This causes every AA in the protein to be different.

Frameshift THE DOG BIT THE CAT. THE DOB ITT HEC AT.

TACTTCAAACCGCGTAACATT TACTTCAACCGCGTAACATT

Point mutations are generally less harmful than frameshift mutations. Do problem solving lab 11-3, page 305.

Chromosomal Mutations When chromosomes get lost, break, or get rearranged incorrectly.

Chromosomal mutations occur in all living organisms, but are especially common in plants. Nondisjunction (failure of the chromosomes to separate.) results in cells with missing or extra chromosomes.

Few chromosome mutations are passed on to the next generation because they usually result in the death of the zygote.

In cases where the zygote lives and matures, the organism is often sterile, thus incapable of producing offspring.

4 most important chromosomal mutations Deletions Insertions Inversions Translocations

Deletion ABCDEFGH ABCEFGH Occur when part of a chromosome is left out.

Insertions ABCDEFGH ABCBCDEFGH Occur when a part of a chromatid breaks off and attaches to its sister chromatid.

Inversions ABCDEFGH ADCBEFGH Occur when part of a chromosome breaks off and reattaches backward.

Translocation ABCDEFGH ABCDEFGHWXYZ Occur when part of one chromosome breaks off and is added to a different chromosome

Causes of Mutations Some just happen, said to be spontaneous. Others are caused by factors in our environment.

MUTAGEN Any agent that can cause a change in DNA. Mutagens include: high energy radiation, chemicals, high temperatures.

HIGH ENERGY X-rays, Cosmic rays, UV radiation, nuclear radiation (gamma, alpha, beta). There high energy causes chemicals in the body to change, often resulting in mutations to DNA.

CHEMICAL Dioxins, asbestos, benzene, cyanide, arsenic, formaldehyde. Cigarettes. Usually result in a substitution mutation.

Fixing DNA Repair mechanisms are found in each cell. Certain enzymes, like book editors, proof read the DNA strands looking for errors and then repair them.