Relationship Between STAT3 Inhibition and the Presence of p53 on Cyclin D1 Gene Expression in Human Breast Cancer Cell Lines Introduction STAT3 and p53 are two conflicting players in the overall scheme of a cancerous mammalian cell. STAT3 is a regulated protein responsible for cell proliferation, angiogenesis, and metastasis (mutated regulation results in cancer). STAT3 is activated by Vascular Endothelial Growth Factor (VEGF), dimerizes, and binds to DNA segments to promote expression in these mechanisms, such as Cyclin D1 for proliferation (Kim et. al 2014). p53 is a protein responsible to detect lethal DNA abnormalities and force cell cycle arrest or apoptosis. The more copies of p53 gene present in an individual’s genome has been found to decrease chance of lethal mutations, and ultimately cancer proliferation (Abegglen et. al 2015). The relationship between the STAT3 and p53 is unknown. MDA 435 cells are more commonly known as the p53 mutant human breast cancer cell line. MCF 7 cells, however, are more commonly known as the p53 wildtype human breast cancer cell line. Hypothesis p53 presence will affect the anti-STAT3 treatment of Cyclin D1 expression. Objective To determine if STAT3 inhibition treatment effectiveness on Cyclin D1 gene expression is dependent on presence of p53 in human cancer cell lines. Benjamin T. Jones, Department of Biology, York College Methods siRNA-STAT3 Plasmid Replication MDA435 Cells p53 Mutants MCF7 Cells p53 Wildtype Control Group No Treatment VEGF Induction Control Group No Treatment VEGF Induction RNA Isolation Reverse Transcriptase Q-PCR of Cyclin D1 Results MDA 435MCF7 3B. 3A. 2A.2B. 3C. Conclusions Least cell proliferation gene (Cyclin D1) expression occurred in treatment groups with no STAT3 presence or VEGF induction. More anti-STAT3 treatment effectiveness observed in cells without p53 Patients lacking p53 protein can possibly be candidates for effective siRNA-STAT3 treatment to suppress proliferation rates. Cyclin D1 18S Figure 1. A 2% agarose gel electrophoresis of Cyclin D1 gene amplification (left set of bands) and 18S control gene amplification (right set of bands). Acknowledgements I would like to thank Dr. Ronald Kaltreider for assisting me through protocols and difficult questions throughout my research. Literature Cited Abegglen, L. et. al Potential mechanisms for cancer resistance in elephants and comparative cellular response to DNA damage in humans. The Journal of the American Medical Association. 314(17): Kim, D., Lee, I., Kim, S., Choi, M., Kim, H., Ahn, S., Saw, P.E., Jeon, H., Lee, Y. and Jon, S A specific STAT3-binding peptide exerts antiproliferation effects and anti-tumor activity by inhibiting STAT3 phosphorylation and signaling. Cancer Research. 74(8): Treatment Groups Control: No siRNA-STAT3, No VEGF No Treatment: siRNA-STAT3, No VEGF VEGF Induction: siRNA-STAT3, VEGF siRNA-STAT3 plasmid transfection using Lyovec 6 well plates used for each cell type 2 replicates per treatment group VEGF was induced through presentation and incubation Primers for CD1 gene (170 bp) were tested for using PCR and gel electrophoresis CD1 Primer Sequence Forward: CCCAGCCATGGAACACCAG Reverse: CAGGACCTCCTTCTGCACAC Size (BP)