Getting Started: What is DNA? Concepts/Vocabulary: – DNA – Nucleotide – Triplet/Codon.

Slides:

Advertisements

Similar presentations

MACROMOLECULES ORGANIC COMPOUNDS.

Advertisements

Nucleic Acids Nucleic Acid Basics Contain instructions to build proteins 2 types: – DNA – RNA Composed of smaller units called nucleotides – Monomer:

Nucleic Acids. Elements Nucleic Acids Contain C, H, O,N, P.

DNA What is it? And what does it do?. What two things did you not know, had forgotten or felt were important?

How DNA helps make you you. DNA Function Your development and survival depend on… Your development and survival depend on…  which proteins your cells.

DNA stands for Deoxyribonucleic acid DNA Structure DNA consists of two molecules that are arranged into a ladder-like structure called a Double Helix.

Unit 2 – PART A Inside the Nucleus DNA Sturcture.

Chapter 6 Genes and Gene Technology

DNA Structure Review. Questions 1.Name the term used to describe the shape of the DNA molecule. 2.What does DNA stand for? 3.What 3 chemicals make up.

Name the organelle and give its function. Cell Parts Review Animal Plant Nucleus Ribosome Endoplasmic Reticulum: aids in processing carbohydrates, lipids.

RNA & Protein Synthesis.

Objective: Understand the function of DNA

Structure and Function

What is this DNA you speak of?  DNA stands for deoxyribonucleic acid - Found in nucleus of eukaryotic cells - Found in cytoplasm of protists.

National 5 Biology Course Notes Part 4 : DNA and production of

Chapter 12 – DNA and Proteins DNA Structure: DNA is made of many smaller subunits called nucleotides.

D.N.A. DeoxyriboNucleic Acid

DNA Deoxyribose Nucleic Acid. DNA (deoxyribonucleic acid) Genetic Information in the form of DNA is passed from parent to offspring. Genes are the code.

What are the parts of DNA? Vocabulary word for chapter 6.

Chapter From DNA to Protein.

DNA RNA DNA Replication & Transcription Translation.

Regents Biology Nucleic Acids Information storage.

 Construct and revise an explanation based on evidence for how carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form.

DNA, mRNA, and Protein Synthesis TAKS Review for April 22 test.

DNA Jeopardy. $ $200 $300 $400 $500 $100 $200 $300 $500 $400 $100 $200 $300 $400 $500 $100 $200 $300 $400 $500 $100 $200 $300 $400 $500.

NUCLEIC ACIDS. The four major classes of macromolecules are: Carbohydrates Proteins Lipids Nucleic acids.

PROTEIN SYNTHESIS Review. Cell organelle where ______________ proteins are made Copying DNA _________________ G roup of 3 nucleotides _____________ in.

DNA and Genes. Prokaryotes VS Eukaryotes Prokaryotes: no defined nucleus and a simplified internal structure Eukaryotes: membrane limited nucleus and.

DNA & RNA. DNA Structure  Double stranded (long)  Nucleotides – deoxyribose, phosphate, Nitrogen base  Nitrogen bases  Adenine  Thymine  Cytosine.

JeopardyNucleicAcidsDNAReplicationRNATranscriptionProteinTranslationEnzymes FINAL JEOPARDY

Nucleic Acids. Nucleic acids are large biomolecules (polymers) – essential for all known forms of life Include DNA and RNA Made from long strands of nucleotides.

DNA Structure and replication.  DNA (deoxyribonucleic Acid) carries the genetic code. DNA Structure.

DNA (Deoxyribonucleic Acid). Watson and Crick DNA Molecules x8b8Ihttp:// x8b8I.

DNA. DNA is the organic molecule Deoxyribonucleic Acid The function of DNA is as a molecule that permanently stores the information or instructions necessary.

Structure of DNA. DNA The nucleic acid that stores and transmits genetic information of a cell from one generation to the next Nucleic = in the nucleus!

NUCLEIC ACIDS. Below is one of the molecules that makes up DNA. What functional groups do you see in the molecule: 1.Hydroxyl group 2.Carboxyl group 3.Amino.

DNA – Show Me What You’re Made of!!

1 DNA The illustration is a ‘model’ of the double helix forming part of a DNA molecule (Slide 14)

Nucleic Acids. Nucleic Acids Made from long strands of nucleotides (monomers) Nucleic acids are large biomolecules (polymers) – essential for all known.

DNA Replication/Transcription/Translation

RNA Ribonucleic Acid Single-stranded

DNA: The Molecule of Life

DNA Deoxyribonucleic Acid

What is the structure and function of DNA?

DNA (Deoxyribonucleic Acid)

AIM: How are DNA molecules structured

That stands for: DEOXYRIBONUCLEIC ACID

The Function and Structure of DNA

NUCLEIC ACIDS THERE ARE TWO DNA (DEOXYRIBONUCLEIC ACID)

What is the structure and function of DNA?

DNA & RNA Notes Unit 3.

DNA – RNA – Protein Synthesis

REVIEW DNA DNA Replication Transcription Translation.

Making Proteins Transcription Translation.

Title: Nucleic Acids

Discovering DNA.

Lesson 8 Nucleic Acids.

RNA: another nucleic acid

Science Review Week 3 DNA and RNA.

LECTURE 3: MICROEVOLUTION PART 1 DNA

Presentation transcript:

Getting Started: What is DNA? Concepts/Vocabulary: – DNA – Nucleotide – Triplet/Codon

Getting Started:

DNA is made up of 3 parts: 1. Nitrogenous Base: Aka nucleotide Adenine (A), Thymine (T), Guanine (G), Cytosine (C) 2. 5 Carbon Sugar Deoxyribose 3. Phosphate group

Getting Started: DNA stands for Deoxyribonucleic Acid. – Let’s break it down: “Deoxyribo” refers to the sugar that makes up much of the DNA molecule. Nucleic refers to the fact that DNA is found in the nucleus of most Eukaryotic organisms Acid refers to the fact that the DNA molecule, when dissolved in pure water makes the water slightly acidic (due to the phosphate group).

Getting Started:

3’5’ TACGTACGGCAATCGATTACGTACGGCAATCGAT ATGCATGCCGTTAGCTAATGCATGCCGTTAGCTA 5’3’ Three nucleotides in a row are called a triplet and/or codon. Each triplet codes for an amino acid. Amino acids are combined in the ribosomes of cells to create proteins. Proteins are essential to living organisms and part of every process that takes place within a cell.