L. COLEMAN 2011. GENE: the section of a DNA molecule that contains the recipe for one protein. NOTE: Each DNA molecule with it’s supporting structures.

Slides:

Advertisements

Similar presentations

Advertisements

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Mutations Hollywood’s images of mutation. Mutations Hollywood’s images of mutation.

Section 13.3/4: “Mutations & Gene Expression” Text Pages

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

Mutations are changes in DNA that may or may not affect phenotype.

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

HW # 80- Make cookies for the Cookie Mutation Lab Warm up What are the different types of mutations? How are mutations related to evolution? Place your.

Mutations Chapter 12.4.

Mutations Genetic Changes.

Changes in DNA that affect genetic information

Don’t let this happen to you!!. MUTATIONS Changes in DNA that affect genetic information.

Mutations. What Are Mutations?  A change in the structure or amount of an organisms genetic material  This mutation can be a tiny change in DNA structure.

DNA Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,

Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

MUTATIONS _______________ are changes in the genetic material. MUTATIONS mistakes REMEMBER! Mutations can happen when cells make _____________ in.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

13.3 Mutations. POINT > Define a gene in simple terms POINT > Define and describe genetic mutations POINT > Distinguish between gene and chromosomal mutations.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)

Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.

Wednesday, January 16 th What is a mutation? Reminders: DNA Test Friday.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Mutations 6/26/2018 SB2d.

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Mutations Add to Table of Contents – p. 14

Mutations LN #23 Ms. Garcia California Content Standard Genetics

A mutation is a change in an organism’s DNA.

Mutations 1) Gene Mutations = change in pattern of DNA bases

Mutations: Changes in Genes

Presentation transcript:

L. COLEMAN 2011

GENE: the section of a DNA molecule that contains the recipe for one protein. NOTE: Each DNA molecule with it’s supporting structures Is called a CHROMOSOME.

1.A Mutation is defined as: A change in the base sequence of a DNA molecule. Point mutation Inversion Deletion. Can be devastating because it changes everything that follows it. THE FAT CAT ATE THE RAT X TEF ATC ATA TET HER AT becomes:

2. Mutations are most likely to happen: During DNA replication because nucleotides are moving into position and not yet bonded together.

3. The effect of a mutation on the function of a gene depends on: How it changes the amino acid sequence and how that change affects the structure and function of the protein. 4. Once a mutation occurs it will be passed on to: All cells descending (by cell division) from the mutated cell - because when DNA replicates it copies the mutation too.

5. The effect of a mutation on an organism depends on: a.How it affects the function of the protein AND what the protein did for the organism - may have no effect, in rare cases may be beneficial, usually harmful. b.What kind of cell has the mutation. c.Developmental stage of the organism. 1.Worst is fetal development - all subsequent cells have the mutation. 2.In adults can result in out-of-control cell division, aka CANCER. 6. Beneficial mutations are why evolution occurs. Without them There could be no natural selection.

7. Mutations are passed from parents to offspring only if: they occur in sperm or egg cells (in sexually reproducing organisms). 8. Mutations can happen as a matter of chance during replication. The probability of a chance mutation occurring when DNA replicates is: 1 mutation/100,000 genes

9. Anything that can penetrate the nucleus of a cell and interfere with the replication process greatly increases the probability of mutation occurring. Such mutation-causing agents are called mutagens and/or carcinogens. Some examples are: a.Radiant energy stronger than visible light: 1)UV radiation 2)X-Ray 3)Gamma radiation (radioactivity)

b. Viruses

c. Chemicals 1) environmental toxins 2) drugs (prescription or otherwise): nicotine, alcohol, cocaine etc.