1. PM703 Practical Biotechnology (2015)

2. Bioinformatics Lab Learn the DNA language Material by Dr. Ramy K. Aziz

3. It’s the language of the future Sup? cu… 4get’t… ^_^ My <3 is broken LOL LMAO 2015 3PM703-Bioinformatics Prelab

4. It’s the language of the future 2025 4PM703-Bioinformatics Prelab ATATAGCACGCAACAGAGTGACCA CATGCTCGAATGGCATGCTACTAG

5. 5 It’s the language of the future 2025 PM703-Bioinformatics Prelab ATATAGCACGCAACAGAGTGACCA CATGCTCGAATGGCATGCTACTAG = I.HATE.PHARMACY.

6. Quick Questionnaire How many of you have worked with DNA? How frequently you use Google or Yahoo search? (Never/ once a week/ once a day/ more) How frequently you use Facebook or Twitter? (Never/ once a week/ once a day/ whenever possible) Who has use PubMed for literature search? (Never/ once a week/ once a day/ more) Who has searched GenBank before? 6PM703-Bioinformatics Prelab

7. Gene : a discrete unit of hereditary information located on the chromosomes and consisting of DNA. Genome : an organism’s genetic material Genotype : The genetic makeup of an organism Phenotype : the physical expressed traits of an organism Nucleic acid : Biological molecules (RNA and DNA) that allow organisms to reproduce. Some Terminology 7PM703-Bioinformatics Prelab

8. Genotype  phenotype 13-20 Nov 20148PM703-Bioinformatics Prelab Credit: V. Fischetti GENOME LIVING CELL

9. Some Terminology The genome is an organism’s complete set of DNA. –a bacteria contains about 600,000 DNA base pairs –human and mouse genomes have some 3 billion. human genome has 24 distinct chromosomes. –Each chromosome contains many genes. Gene –basic physical and functional units of heredity. –specific sequences of DNA bases that encode instructions on how to make proteins. Proteins –Make up the cellular structure –large, complex molecules made up of smaller subunits called amino acids. 9PM703-Bioinformatics Prelab

10. DNA sequence looks like… 13-20 Nov 201410PM703-Bioinformatics Prelab.....acctc ctgtgcaaga acatgaaaca cctgtggttc ttccttctcc tggtggcagc tcccagatgg gtcctgtccc aggtgcacct gcaggagtcg ggcccaggac tggggaagcc tccagagctc aaaaccccac ttggtgacac aactcacaca tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc acggtgccca gagcccaaat cttgtgacac acctccccca tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc ccggtgccca gcacctgaac tcttgggagg accgtcagtc ttcctcttcc ccccaaaacc caaggatacc cttatgattt cccggacccc tgaggtcacg tgcgtggtgg tggacgtgag ccacgaagac cccgaggtcc agttcaagtg gtacgtggac ggcgtggagg tgcataatgc caagacaaag ctgcgggagg agcagtacaa cagcacgttc cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaacggcaa ggagtacaag tgcaaggtct ccaacaaagc aaccaagtca gcctgacctg cctggtcaaa ggcttctacc ccagcgacat cgccgtggag tgggagagca atgggcagcc ggagaacaac tacaacacca cgcctcccat gctggactcc gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg aacatcttct catgctccgt gatgcatgag gctctgcaca accgctacac gcagaagagc ctctc..... Computer scientists view DNA as nothing more than a string of letters like any other ‘text.’

11. The Flow of Information In a Computer Can you just copy an installed program to make it run on another computer? in most cases, NO! 11PM703-Bioinformatics Prelab

12. The Flow of Information In a Computer Stored code (backup) Copied code, ready to install Download from Internet or disk Unzip/ uncompress (optional) Functional code, ready to run Install (extract files/ drivers/ libraries) 12PM703-Bioinformatics Prelab

13. The Flow of Information In The Cell TranslationTranscription Replication An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info 13PM703-Bioinformatics Prelab

14. DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and C-G on complimentary strands. An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info 14PM703-Bioinformatics Prelab

15. A gene codes for a protein Protein mRNA DNA transcription translation CCTGAGCCAACTATTGATGAA PEPTIDEPEPTIDE CCUGAGCCAACUAUUGAUGAA 15PM703-Bioinformatics Prelab

16. Cell Information: Instruction book of Life DNA, RNA, and Proteins are examples of strings written in either the four-letter nucleotide of DNA and RNA (A C G T/U) or the twenty-letter amino acid of proteins. Each amino acid is coded by 3 nucleotides called codon. (Leu, Arg, Met, etc.) An Introduction to Bioinformatics Algorithmswww.bioalgorithms.info 16PM703-Bioinformatics Prelab

17. The Genetic Code 17PM703-Bioinformatics Prelab

18. The Genetic Code 18PM703-Bioinformatics Prelab

19. Amino acids are different 19PM703-Bioinformatics Prelab

20. Do You Speak MolBio? What is the reverse, the complement, the reverse complement, and the message of: AAGGCCTTGCTTCG What is the amino acid encoded by: GUC Translate: AGC ATG ATT CTG GAA TAG CTA G Reverse translate these peptides: PHARMACY, HAPPY Write your name using the genetic code (ignore non-applicable letters) 20PM703-Bioinformatics Prelab

21. Do You Speak MolBio? Lab activity Practical exercise: Sickle cell Frame/translation exercise 21PM703-Bioinformatics Prelab

22. Thank you for your attention. Questions?? 22PM703-Bioinformatics Prelab