1. Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State University

2. Host resistance mechanism against Anthracnose caused by Colletotrichum acutatum

3. Anthracnose ripe fruit rot Lesions are more sunken under dry condition while salmon color spore mass is common under high relative humidity on less sunken lesions

4. All parts of strawberry are susceptible to C. acutatum Anthracnose petiole rot, flower blight & green fruit rot Symptom on green fruit

5. AFR incidence on 14 genotypes in plasticulture system, ‘07 & ‘08

6. Invitro evaluation of anthracnose fruit rot severity

7. Rank sum method  a, b and c are genotype ranking using lesion diameter at 8 DAI from three different experiments;  d= rank-sum (a + b +c) for each genotype;  e = deviation from the grand mean (G) of the rank-sums ([e = (d –G)/standard deviation] × 3).

8. Invitro AFR resistance Seascape is a day-neutral (everbearing) cultivar NC C02-63 is a short-day advance breeding line

9. Selection of genotypes possessing QI and AFR resistance

10. Variability in overall resistance explained by true fruit resistance and resistance quiescent infection a Confidence limit Resistance typeR2R2 Adjusted R 2 Approx 95% CL a for R 2 F- value Pr>F Lower CLUpper CL Lesion diameter0.600.570.160.8518.630.0010 Quiescent infection severity 0.280.230.010.664.780.0494

11. Correlation of field AFR incidence with induced level of defense enzyme

12. Detection and quantification of Colletotrichum spp from quiescent infections

13. Development of a real time PCR protocol for QI The primer/probe set and capture probe was designed from the consensus sequence using Beacon Designer software from 45 ITS sequences of C. acutatum and C. gloeosporioides. b DMT-Difference in melting temperature of amplicons from C. acutatum and C. gloeosporioides template when reverse primer is used with different combinations of forward primers.

14. Species discrimination by melt curve analysis glo GCTTGGTGTTGGGGCCCT ACAGCTGATGT AGGCCCTCAAAGGTAGTGGCGGACCCTCCCG acu GCTTGGTTTT GGGGCCCCACGGCCGACGTGGGCCCTT AAAGGTAGTGGCGGACCCTCCCG glo GAGCCTCCTTTGCGTAGTAACTTT ACGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGT acu GAGCCTCCTTTGCGTAGTAACT - AACGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGT glo AAAACC acu T AAACC SNP classBase changeTypical T m melt curve shift 1C/T and G/ALarge (>0.5°C) 2C/A and G/T 3C/G 4A/TVery Small (<0.2°C) Primer binding site

15. Melt curve (HRM) analysis in Rotor gene 6000 qPCR system C. gloeosporioidesC. acutatum

16. Utilization of the tool in assessing field samples  Superior detection capacity  Superior in terms of “sensitivity, specificity and speed”  Lowest detection limit is 5 cfu/1pg

17. AFR prediction based on foliar quiescent infection 2009 No AFR

18. Chemical control of AFR 2008 Treatments and rates (units product/A)Schedule AFR Inc (%) Yield (M) (lb/A) Not-treated…………………………………….---46.72 a12,685 c Captan 50 WP 4.0 lb +Topsin-M 70WP 1.1 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb Abound 25 SC..………………………………. Spray# 1 Spray# 2,4 Spray# 3,5,7,9 Spray# 6,8 21.60 c20,151 a Captan 50WP 4.0 lb + Topsin-M 70 WP 1.1lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb……………………. Spray# 1 Spray# 2,4 Spray# 3 29.87 bc18,130 ab Captan 50 WP 4.0 lb +Topsin-M 70WP 1.1 lb Distinguish 16 fl. oz………………………….. Spray#1,3,5,7,9 Spray#2,4,6,8 33.89 b16,832 abc Captan 50 WP 4.0 lb +Topsin-M 70WP 1.1 lb Abound 25 SC……………………………….. Spray#1,3,5,7,9 Spray#2,4,6,8 44.72 a16,135 abc

19. Efficacy of reduced spray schedule and premixed active ingredients ‘09 Fungicide rate (formulation/acre) z *Schedule y AFR Inc(%) w,x Yield/plant(g) w Non-treated……………………………………xxx 37.55 a 233.94 c Captan 50 WP 4.0 lb + Topsin M 70 W 1.0 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb Abound 25 SC..………………………………. spray #1 spray #2,4 spray # 3,5,7 spray # 6,8 7.19 c 330.06 ab Captan 50 WP 4.0 lb + Topsin M 70 W 1.0 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb…………………….. spray #1 spray #2,4 spray # 3 11.00 bc 329.9 ab A16001EW 14.0 fl Oz Captan 50 WP 4.0 lb………………………….. Spray#1,2,4,5 Spray#3 19.37 b 283.61 bc A13703 SC14.0 fl Oz Captan 50 WP 4.0 lb………………………….. Spray#1,2,4,5 Spray#3 15.54 b 392.63 a A16001EW = a premix of difenoconazole + cyprodinil (Inspire Super). A13703 = a premix of difenoconazole + azoxystrobin (Quadris Top).

20. Precision disease management for sustainable strawberry production in the Southeast U.S/Prediction based spray program  The variable %INF is calculated from the equation:  In (%INF / [1-%INF]) = -3.70 + 0.33W – 0.069WT + 0.0050WT2 – 0.93 x 10 – 4 WT3 where W = the duration of a preceding wetness interval and T= mean temperature( 0 C) during the interval.  If threshold expressed by %INF is 0.15 will indicate the need for Captan spray  When threshold reaches 0.50 will indicate the need for pyraclostrobin spray

21. Skybit weather forecast E-WEATHER FORECAST AND SUMMARY For: NC-NEW HANOVER-CASTLE HAYNE Date: THU JUN 3, 2010 DATE Jun 3 Jun 4 HOUR (EDT) 8a 11a 2p 5p 8p 11p 2a 5a 8a 11a 2p 5p 8p 11p ------------------------------------------------------------------------------ TEMP (F) 75 83 86 84 79 75 74 73 75 84 87 85 80 76 2"- SOIL TEMP (F) 77 81 84 86 85 82 78 75 76 80 84 87 86 82 REL HUM (%) 91 71 63 68 79 89 91 95 90 66 58 63 76 89 6HR PRECIP(in).00/.00/.00/.00/.00/.00/.00/ 6HR PRECIP PROB(%) 19/ 13/ 22/ 13/ 16/ 9/ 23/ 3HR EVAP (in).02.06.11.10.04.00.00.00.01.07.12.10.04.02 3HR WETNESS (hrs) 2 2 0 0 0 0 1 3 3 3 0 0 0 0 WIND DIR (pt) SSW SW SSW SSW SSW SSW SSW SW WSW WSW SSW S SSW SW WIND SPEED (mph) 6 9 10 11 8 4 4 5 6 6 7 11 7 3 CLOUD COVER OVC BKN BKN BKN SCT BKN BKN BKN BKN SCT SCT BKN OVC OVC 3HR RADIATION (ly) 8 88 173 149 59 1 0 0 18 126 208 166 48 0 PCT RADIATION (%) 32 56 71 70 74 100 --- --- 72 79 85 78 60 0

23. HOBO leaf wetness smart sensor SENSOR

24. Determination of wetness hours

25. Prediction based spray schedule Treatments# of sprays applied AFR inciden ce (%) ab Marketable yield (lb/plant) b Non treated control-8.45 a0.73 b Regular Schedule Captan 50WP 4.0 lb + Topsin M 70W 1.0 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb Pristine WG 1.45 lb ……………………… 1 2, 4 3, 5, 7 6, 8 3.22 b0.87 a Prediction based schedule Captan 50WP 4.0 lb Pristine WG 1.45 lb 123123 4.43 b0.75 ab a Disease incidence was calculated from all harvested fruits over 8 weeks b Means in a column followed by the same letter are not significantly different by Fisher’s protected LSD test (α ≤ 0.05).

26. Host Resistance Integrated Strawberry Disease Management Reduced spray schedule Optimum fertility Calcinit-Ca(NO 3 ) 2 Treatment (rate/A) Schedule y Gray mold (%) Non-treated…n.a.17.8 a Captan + Topsin-M Pristine Switch Pristine…….. Spray# 1 Spray#2 Spray#3 Spray# 4 7.3 b Captan+ Topsin-M Pristine Switch………. Spray# 1 Spray# 2,4,6,8 Spray# 3,5,7,9 6.1 b ing stock Removal of senesced tissue & Sensitive Detection Tool Quiescently Infected – exclude from planting stock Infected fruits Weather based Prediction

27. Acknowledgements  Mike Carnes and Jim Driver  NC strawberry growers association  North American Strawberry growers association  California strawberry commission  Southern region IPM center  SkyBit - ZedX, Inc SkyBit - ZedX, Inc.