1. Lecture 5: Genetic Variation and Inbreeding August 31, 2015

2. Last Time uSandy Simon guest lecture: measuring genetic variation at the nucleotide level uBefore that: uHardy-Weinberg Equilibrium uUsing Hardy-Weinberg: Estimating allele frequencies for dominant loci uVariance of allele frequencies for dominant loci uHypothesis testing

3. If nucleotides occur randomly in a genome, which sequence should occur more frequently? AGTTCAGAGT AGTTCAGAGTAACTGATGCT What is the expected probability of each sequence to occur once? How many times would each sequence be expected to occur by chance in a 100 Mb genome?

4. AGTTCAGAGT What is the expected probability of each sequence to occur once? What is the sample space for the first position? ATGCATGC Probability of “A” at that position? Probability of “A” at position 1, “G” at position 2, “T” at position 3, etc.? AGTTCAGAGTAACTGATGCT

5. AGTTCAGAGT How many times would each sequence be expected to occur in a 100 Mb genome? AGTTCAGAGTAACTGATGCT Why is this calculation wrong?

6. AB AGTTCAGAGTAACTGATGCT UCA AGU CUC AUU GAC UAC GA Ser Cys Phe Ile Asp Tyr UGA AGU CUC AUU GAC UAG GA Stop Cys Phe Ile Asp Stop

7. Today uMeasures of diversity uMore Hardy-Weinberg Calculations  Merle Patterning in Dogs uFirst Violation of Hardy-Weinberg assumptions: Random Mating uEffects of Inbreeding on allele frequencies, genotype frequencies, and heterozygosity

8. Expected Heterozygosity  2pq for 2-allele, 1 locus system OR  1-(p 2 + q 2 ) or 1-Σ(expected homozygosity) more general: what’s left over after calculating expected homozygosity Homozygosity is overestimated at small sample sizes. Must apply correction factor: Correction for bias in parameter estimates by small sample size If a population is in Hardy-Weinberg Equilibrium, the probability of sampling a heterozygous individual at a particular locus is the Expected Heterozygosity:

9. Maximum Expected Heterozygosity uExpected heterozygosity is maximized when all allele frequencies are equal uApproaches 1 when number of alleles = number of chromosomes uFrequency of each allele: uDoes this make sense? Also see Example 2.11 in Hedrick text uApplying small sample correction factor:

10. Observed Heterozygosity uProportion of individuals in a population that are heterozygous for a particular locus: uDifference between observed and expected heterozygosity will become very important soon uThis is NOT how we test for departures from Hardy- Weinberg equilibrium! Where N ij is the number of diploid individuals with genotype A i A j, and i ≠ j, And H ij is frequency of heterozygotes with those alleles

11. Alleles per Locus uN a : Number of alleles per locus uN e : Effective number of alleles per locus  Same as n e in your text If all alleles occurred at equal frequencies, this is the number of alleles that would result in the same expected heterozygosity as that observed in the population

12. Calculate H e, N a and N e AlleleFrequency A10.01 A20.01 A30.98 AlleleFrequency B10.3 B20.3 B30.4 Locus ALocus B Example: Assay two microsatellite loci for WVU football team (N=50)

13. Measures of Diversity are a Function of Populations and Locus Characteristics Assuming you assay the same samples, order the following markers by increasing average expected values of N e and H E : RAPD SSR Allozyme

14. Example: Merle patterning in dogs Clarke et al. 2006 PNAS 103:1376 uMerle or “dilute” coat color is a desired trait in collies, shetland sheepdogs (pictured), Dachshunds and other breeds uHomozygotes for mutant gene lack most coat color and have numerous defects (blindness, deafness) uCaused by a retrotransposon insertion in the SILV gene

15. Example: Merling Pattern in collies Homozygous wild-type N=6,498 M1M1M1M1 Heterozygotes N=3,500 M1M2M1M2 Homozygous mutants N=2 M2M2M2M2 uIs the Merle coat color mutation dominant, semi-dominant (incompletely dominant), or recessive? uDo the Merle genotype frequencies differ from those expected under Hardy-Weinberg Equilibrium?

16. Why does the merle coat coloration occur in some breeds but not others? How did we end up with so many dog breeds anyway?

18. Nonrandom Mating: Inbreeding uInbreeding: Nonrandom mating within populations resulting in greater than expected mating between relatives uAssumptions (for this lecture): No selection, gene flow, mutation, or genetic drift uInbreeding very common in plants and some insects uPathological results of inbreeding in animal populations  Recessive human diseases  Endangered species http://i36.photobucket.com/albums/e4/doooosh/microcephaly.jpg

19. Important Points about Inbreeding uInbreeding affects ALL LOCI in genome uInbreeding results in a REDUCTION OF HETEROZYGOSITY in the population uInbreeding BY ITSELF changes only genotype frequencies, NOT ALLELE FREQUENCIES and therefore has NO EFFECT on overall genetic diversity within populations uInbreeding equilibrium occurs when there is a balance between the creation (through outcrossing) and loss of heterozygotes in each generation

20. Inbreeding can be quantified by probability (f) an individual contains two alleles that are Identical by Descent A1A2A1A2 A3A4A3A4 A1A3A1A3 A2A3A2A3 A3A3A3A3 A2A3A2A3 A1A2A1A2 A3A4A3A4 A1A3A1A3 A2A3A2A3 A3A5A3A5 A3A3A3A3 A2A3A2A3 Identical by descent (IBD) Identical by state (IBS) Identical by descent (IBD) P F1F1 F2F2