Presentation is loading. Please wait.

Presentation is loading. Please wait.

Slide 4.1 Lesson 4 How similar or different are cells? Skin cellsBlood cells.

Published byPosy Grant Modified over 8 years ago

Similar presentations

Presentation on theme: "Slide 4.1 Lesson 4 How similar or different are cells? Skin cellsBlood cells."— Presentation transcript:

1 Slide 4.1 Lesson 4 How similar or different are cells? Skin cellsBlood cells

2 Slide 4.2 Lesson 4 1) Prepare gel Image from powerful microscope gel Holes for samples to be tested

3 Slide 4.3 Lesson 4 2) Put protein sample in hole Pipet with solution of proteins Lots of different sized proteins

4 Slide 4.4 Lesson 4 3) Include all the samples you want to test lactase tyrosinase

5 Slide 4.5 Lesson 4 4) Provide power to the electrodes Negatively charged proteins move towards positive electrode larger proteins smaller proteins

6 Slide 4.6 Lesson 4 5a) Proteins separate based on size lactase tyrosinase

7 Slide 4.7 Lesson 4 5b) Judging the amount of protein A little lactase A lot of lactase

8 Slide 4.8 Lesson 4 5c) Analyzing RNA Longer RNA Shorter RNA

9 Slide 4.9 Lesson 4 6) Take a picture to record your work

10 Slide 4.10 Lesson 4 Lactose intolerance in Jason’s family Lactose intolerance: 1)No (Mom) 2)Yes (Jason) 3)No (Chelsea) 4)No (Maya)

11 Slide 4.11 Lesson 4 Results: DNA sequence analysis of lactase gene: Mom:no mutations in lactase genes Jason:no mutations in lactase genes Chelsea:no mutations in lactase genes Maya:no mutations in lactase genes

12 Slide 4.12 Lesson 4 Results: RNA analysis of lactase gene 213 Lactose intolerance: 1)No (Mom) 2)Yes (Jason) 3)No (Chelsea) 4)No (Maya) 4

13 Slide 4.13 Lesson 4 213 Lactose intolerance: 1)No (Mom) 2)Yes (Jason) 3)No (Chelsea) 4)No (Maya) Why does Jason have no protein? Why Mom and Chelsea have less protein? Gel electrophoresis: Lactase samples from 4 people 4

14 Slide 4.14 Lesson 4 Results: DNA sequence of area near the lactase gene Mom: ATTTGC Jason: ATCTGC TAAACGTAGACGATCTGCTAGACG Chelsea: ATCTGC Maya: ATTTGC TAGACGTAAACGATTTGCTAAACG

15 Slide 4.15 Lesson 4 Erythropoietin (EPO) AGCTTCCCGGGATGAGGGCCC TCGAAGGGCCCTACTCCCGGG environment gene protein cells Small amount of oxygen O-O Lots of oxygen O-O gene “on” some of the timegene “on” most of the time some protein lots of protein some cells lots of cells AGCTTCCCGGGATGAGGGCCC TCGAAGGGCCCTACTCCCGGG

Download ppt "Slide 4.1 Lesson 4 How similar or different are cells? Skin cellsBlood cells."

Similar presentations

Amanda Barrera Biology Honors Period 1

Amanda Barrera Biology Honors Period 1
PACKET 11- DNA TECHNOLOGY. WHAT DO WE ALREADY KNOW ABOUT DNA?  DNA is __________ stranded  DNA is made up of four bases: ____, ____,_____, and _____.

PACKET 11- DNA TECHNOLOGY. WHAT DO WE ALREADY KNOW ABOUT DNA?  DNA is __________ stranded  DNA is made up of four bases: ____, ____,_____, and _____.
DNA Techniques Lab Preparation 13-1 Manipulating Genes Genetic Engineering: You can repair genes, insert genes, excise genes or replace genes with gene.

DNA Techniques Lab Preparation 13-1 Manipulating Genes Genetic Engineering: You can repair genes, insert genes, excise genes or replace genes with gene.
Sudden Death and Sickle Cell Trait: How Knowing Your Genes Can Save Your Life Dale Lloyd II, No. 39. (The Rice Football Webletter) 2006 After running 16.

Sudden Death and Sickle Cell Trait: How Knowing Your Genes Can Save Your Life Dale Lloyd II, No. 39. (The Rice Football Webletter) 2006 After running 16.
Do Now:. DNA Fingerprinting Everyone (except identical twins) has a unique DNA sequence in their cells. A technique called ________________________can.

Do Now:. DNA Fingerprinting Everyone (except identical twins) has a unique DNA sequence in their cells. A technique called ________________________can.
Gel Electrophoresis.

Gel Electrophoresis.
Introduction to DNA.

Introduction to DNA.
Agarose Gel Electrophoresis 1Dr. Nikhat Siddiqi. Agarose is a linear polymer made up of the basic repeating unit of agarobiose which comprises alternating.

Agarose Gel Electrophoresis 1Dr. Nikhat Siddiqi. Agarose is a linear polymer made up of the basic repeating unit of agarobiose which comprises alternating.
* Technique used to separate samples of DNA, RNA, and protein according to charge and/or size * Smaller molecules move farther and faster through the.

* Technique used to separate samples of DNA, RNA, and protein according to charge and/or size * Smaller molecules move farther and faster through the.
Y.Martinez.

Y.Martinez.
(RFLP Electrophoresis)

(RFLP Electrophoresis)
Connect!  What is physical therapy?  What is respiratory therapy?  What does “therapy” mean?  So, what do you think “gene therapy” might mean?

Connect!  What is physical therapy?  What is respiratory therapy?  What does “therapy” mean?  So, what do you think “gene therapy” might mean?
Electrophoresis. Means literally to “carry with electricity.” Used to separate charged molecules such as DNA, RNA, & proteins. Larger (heavier) particles.

Electrophoresis. Means literally to “carry with electricity.” Used to separate charged molecules such as DNA, RNA, & proteins. Larger (heavier) particles.
Unit 8 test Biotech study guide.

Unit 8 test Biotech study guide.
Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall
DNA Fingerprinting. We share 99.9% of our DNA with each other. That means the 0.1% of our DNA makes us unique. But that is still is over 3,000,000 differences!

DNA Fingerprinting. We share 99.9% of our DNA with each other. That means the 0.1% of our DNA makes us unique. But that is still is over 3,000,000 differences!
Group of people% people with lactose intolerance Americans of European descent 12% African Americans75% Native Americans100% Mexican Americans 55% English10%

Group of people% people with lactose intolerance Americans of European descent 12% African Americans75% Native Americans100% Mexican Americans 55% English10%
III Manipulating DNA. The Tools of Molecular Biology How do scientists make changes to DNA? The Tools of Molecular Biology.

III Manipulating DNA. The Tools of Molecular Biology How do scientists make changes to DNA? The Tools of Molecular Biology.
Slide 2.1 Lesson 2 Special Skin Cells Make Melanin body epidermis How is melanin made inside the melanocytes? epidermis melanocytes tissue cells.

Slide 2.1 Lesson 2 Special Skin Cells Make Melanin body epidermis How is melanin made inside the melanocytes? epidermis melanocytes tissue cells.
13-1 Changing the Living World

13-1 Changing the Living World

Similar presentations

Ads by Google