Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA and RNA What does DNA look like? What are the elements that makeup DNA?

Similar presentations

Presentation on theme: "DNA and RNA What does DNA look like? What are the elements that makeup DNA?"— Presentation transcript:

1 DNA and RNA What does DNA look like? What are the elements that makeup DNA?

2 DNA Structure= String of nucleotides (sugar, phosphate, base) *Adenine *Thymine *Guanine *Cytosine purines - adenine, guanine pyrimidines - cytosine, thymine

3 PurinesPyrimidines AdenineGuanine CytosineThymine Phosphate group Deoxyribose Figure 12–5 DNA Nucleotides

4 Francis Crick and James Watson (1953) Twisted Double Helix Hydrogen Bonds are the glue that keeps the two strands together Each strand of the helix is a chain of nucleotides What holds the strands together?


6 Hydrogen bonds Nucleotide Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Figure 12–7 Structure of DNA

7 How is DNA organized in a chromosome? Remember Chromatin?? DNA tightly coiled around proteins forming Chromatin which pack together to form thick fibers. What exactly is chromatin? ONE nucleus of ONE human cell = more than 1 meter of DNA!!!

8 Chromosome E. coli bacterium Bases on the chromosome Prokaryotic Chromosome Structure Section 12-2

9 Chromosome Structure of Eukaryotes Chromosome Supercoils Coils Nucleosome Histones DNA double helix

10 How can DNA use its double-stranded structure to its advantage for replication???

11 Something Old…Something New

12 DNA Replication When does this occur in the cell cycle? 1) Enzymes un-twist and unzip the molecule (break H bonds between base pairs). 2) Each strand serves as a template (something OLD) 3) Free nitrogen bases form bonds and make complementary strands (Something NEW) Template 4) DNA Polymerase bonds the nucleotides and proofreads the molecule

13 Figure 12–11 DNA Replication Growth Replication fork DNA polymerase New strand Original strand DNA polymerase Nitrogenous bases Replication fork Original strand New strand

14 DNA vs. RNA RNA – also a long chain of nucleotides (5- carbon sugar, phosphate group, nitrogenous base) Differences: 1. RNA sugar = ribose, instead of deoxyribose 2. RNA – usually single-stranded 3. RNA has uracil to replace thymine (so U binds with A) Always United & Great Couple

15 RNA is in charge of assembling Amino Acids into Proteins

16 From DNA(Gene) to Protein rRNA - ribosomal RNA - location of protein synthesis uses tRNA to make proteins The players: DNA - sequences of nitrogen bases forms the genetic code mRNA - messenger RNA - makes a copy of the DNA in the nucleus and brings it to the rRNA tRNA - transfer RNA - reads the mRNA and brings specific amino acids to the rRNA

17 Step 1: Transcription = recording the message Occurs in nucleus New mRNA strand forms from one of DNA strands (creating the message) Lets Practice…

18 Transcription Practice Transcribe the DNA molecule below: ATTATCGCGTAATGCTAATAGC TAATAGCGCATTACGATTATCG Template AUUAUCGCGUAAUGCUAAUAGC mRNA transcript

19 RNA DNA RNA polymerase Figure 12–14 Transcription Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only)

20 Step 2: Editing of mRNA Introns are removed – non coding regions of the DNA molecule Exons remain – sequences that will be expressed

21 Step 3: Translation = Protein Synthesis Occurs at ribosome tRNA reads mRNA which has message from genetic code (DNA) Genetic code is read 3 letters at a time, so each word is 3 bases long

22 Every 3 letters is a CODON Each codon codes for a specific amino acid. What does an Amino Acid do again?Helps make proteins! We need codons for Protein Synthesis (Translation) They are like directions to make proteins Every set of directions tells you where to START and where to STOP We too have these, we call them the start and stop codons

23 Codons to remember… START is always: AUG STOP is always: UAA UAG UGA

24 Translation Explained tRNA UAC mRNA AUGCGCAUAACGCAU Start Codon methionine

25 Alternate sequence: There are 20 different amino acids to be coded for. There are 64 possible codons. Start codon Stop codon

26 Figure 12–17 The Genetic Code

27 Translation Practice Make a polypeptide (chain of amino acids) chain from the mRNA molecule AUGAUCGCGUAUUGCUACUAG - mRNA methionine-isoleucine-alanine-tyrosine-cysteine-tyrosine STOP

28 Figure 12–18 Translation Section 12-3

29 Figure 12–18 Translation (continued) Section 12-3

30 Mutations - changes in the DNA sequence Gene mutation- changes in a single gene Point Mutations - substitution of one nucleotide for another Frame Shift Mutations - shifting of the genetic code due to insertion or deletion of nucleotide Chromosomal mutation changes in the entire chromosome (containing many genes)

31 Deletion Duplication Inversion Translocation Figure 12–20 Chromosomal Mutations

32 Mutation Analogy THE FAT CAT ATE THE RAT substitution THE FAT CAT ATE THE CAT * The letter C was substituted for the R insertionTHE FAT CAT ATE THE RAT THC EFA TCA TAT ETH ERA T *Because the C was added, all other letters shifted down, thereby changing the amino acids that are made. C DeletionTHE FT CAT ATE THE RAT THE FTC ATA TET HER AT *Again, the amino acids will change b/c the F was removed A

33 Mutation Practice What will the new amino acid be if the 5th nucleotide is substituted with an adenine? AUGA CGCGUAUUGCUACUAG - mRNAU What will the new amino acid sequence be if a guanine is inserted between the 9th and 10th nucleotide ? ASPARAGINE G GUA = VALINE

34 When a mutation occurs… If the amino acid sequence is stopped early (a STOP codon is reached) = Nonsense If the amino acid sequence continues but the wrong amino acids are coded for = Missense

35 Putting it all together What is the amino acid sequence that forms from the following DNA molecule? (DNA synthesis) TACTACACCGTATAACAGGGCCTAGCAACT Template ATGATGTGGCATATTGTCCCGGATCGTTGA

36 (Transcription) DNA - TACTACACCGTATAACAGGGCCTAGCAACT mRNA - AUGAUGUGGCAUAUUGUCCCGGAUCGUUGA (Translation) amino acid sequence methionine-methionine-tryptophan-histidine- isoleucine-valine-proline-aspartic acid-arginine-stop

Download ppt "DNA and RNA What does DNA look like? What are the elements that makeup DNA?"

Similar presentations

Ads by Google