Download presentation
Presentation is loading. Please wait.
Published byThomas Morris Modified over 8 years ago
1
Chapter 12 : DNA and RNA What does DNA look like? What are the elements that makeup DNA?
2
What is DNA? Discovered by Watson & Crick in 1953 A long molecule made up of units, called nucleotides Genes are made of DNA Described as a twisted ladder, or a double helix
3
Made up of nucleotides Each nucleotide has 3 parts * a sugar called deoxyribose * a phosphate group * a nitrogen base There are 4 nitrogen bases: purines - adenine, guanine pyrimidines - cytosine, thymine * Every purine pairs with a pyrimidine in order to make a DNA chain DNA Structure
4
PurinesPyrimidines AdenineGuanine CytosineThymine Phosphate group Deoxyribose Figure 12–5 DNA Nucleotides
5
Twisted double helix made of two strands Each strand of the helix is a chain of nucleotides Held together by hydrogen bonds
6
Always Together….Great Couple A & TG & C Every nucleotide is paired with a another from the opposite strand. Each pair is specific (Chargaff’s Rule). Adenine and Thymine pair together Guanine and Cytosine pair together Base Pairing of Nucleotides
7
Hydrogen bonds Nucleotide Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Figure 12–7 Structure of DNA
8
How is DNA organized in a chromosome? A nucleus of ONE human cell has more than 1 meter of DNA!!! Chromatin: a substance consisting of DNA tightly coiled around proteins called histones. The DNA and histones together are called nucleosomes (bead-like structure)
9
Figure 12-10 Chromosome Structure of Eukaryotes Chromosome Supercoils Coils Nucleosome Histones DNA double helix
10
Chromosome E. coli bacterium Bases on the chromosome Prokaryotic Chromosome Structure Section 12-2
12
How can DNA use its double-stranded structure to its advantage for replication???
13
DNA Replication (Refer to Figure 12-11) When does this occur in the cell cycle? 1) Enzymes un-twist and unzip the molecule (break H bonds between base pairs). 2) Each strand serves as a template 3) Free nitrogen bases form bonds and make complementary strands which follow the base pairing rules. Template
14
Figure 12–11 DNA Replication Growth Replication fork DNA polymerase New strand Original strand DNA polymerase Nitrogenous bases Replication fork Original strand New strand
15
DNA vs. RNA RNA – also a long chain of nucleotides (5- carbon sugar, phosphate group, nitrogenous base) Differences: 1. RNA sugar = ribose, instead of deoxyribose 2. RNA – usually single-stranded 3. RNA does not have thymine. 1. Uracil instead. 2. Adenine and Uracil pair
16
RNA is in charge of assembling Amino Acids into Proteins
17
Transcription: a sequence of DNA is copied into an RNA strand Transcribe the DNA molecule below: TAATAGCGCATTACGATTATCG AUUAUCGCGUAAUGCUAAUAGC RNA will only start and stop at specific regions of the DNA called promoters.
18
We need codons for Protein Synthesis. They are directions to make proteins Every set of directions tells you where to START and where to STOP (start and stop codons) AUG: STARTUAA, UAG, UGA: STOP Proteins are made by joining amino acids into long chains (POLYPEPTIDES) Each polypeptide consists of a combo of any or all 20 amino acids. Amino acids contain 3 nucleotides. The 3 nucleotides are read as a code called a codon. A CODON specifies a single AA that is added to the polypeptide.
19
Translation Explained tRNA UAC mRNA AUGCGCAUAACGCAU Start Codon Anticodon methionine
20
Figure 12–17 The Genetic Code
21
Translation Practice Make a polypeptide (chain of amino acids) chain from the mRNA molecule AUGAUCGCGUAUUGCUACUAG - mRNA methionine-isoleucine-alanine-tyrosine-cysteine-tyrosine STOP
22
Mutations - changes in the DNA sequence Gene mutation- changes in a single gene Chromosomal mutation changes in the entire chromosome (containing many genes) 1)Point Mutations - substitution of one nucleotide for another 2) Frame Shift Mutations - shifting of the genetic code due to insertion or deletion of nucleotide
23
Mutation Analogy THE FAT CAT ATE THE RAT substitution THE FAT CAT ATE THE CAT * The letter “C” was substituted for the “R” insertionTHE FAT CAT ATE THE RAT THC EFA TCA TAT ETH ERA T *Because the “C” was added, all other letters shifted down, thereby changing the amino acids that are made. C DeletionTHE FT CAT ATE THE RAT THE FTC ATA TET HER AT *Again, the amino acids will change b/c the “F” was removed A
24
Mutation Practice What will the new amino acid be if the 5th nucleotide is substituted with an adenine? AUGA CGCGUAUUGCUACUAG - mRNAU What will the new amino acid sequence be if a guanine is inserted between the 9th and 10th nucleotide ? ASPARAGINE G GUA = VALINE
25
Putting it all together What is the amino acid sequence that forms from the following DNA molecule? (DNA synthesis) TACTACACCGTATAACAGGGCCTAGCAACT Template ATGATGTGGCATATTGTCCCGGATCGTTGA
26
(Transcription) DNA - TACTACACCGTATAACAGGGCCTAGCAACT mRNA - AUGAUGUGGCAUAUUGUCCCGGAUCGUUGA (Translation) amino acid sequence methionine-methionine-tryptophan-histidine- isoleucine-valine-proline-aspartic acid-arginine-stop
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.