Presentation is loading. Please wait.

Presentation is loading. Please wait.

Table S1. List of primers used for the amplification of DNA fragments that were used as probes for Northern blot analysis. Primer nameSequence 5`-3`cDNA.

Similar presentations


Presentation on theme: "Table S1. List of primers used for the amplification of DNA fragments that were used as probes for Northern blot analysis. Primer nameSequence 5`-3`cDNA."— Presentation transcript:

1 Table S1. List of primers used for the amplification of DNA fragments that were used as probes for Northern blot analysis. Primer nameSequence 5`-3`cDNA Product size (bp) Accession number Gene AtNPR1-FGAGGACACACTGGTTATACTC691EF470707non- expressor of PR1 (NPR1) AtNPR1-RCCAGATCGAGCAGCGTCATCTT PR1-FTGCCCAAGACTCACAACAAG238CK Putative PR1 PR1-RGGCCTTCTCATTAACCCACA PR10-FTACTATTGAAGCCGCCAAGG399AF305067PR10 PR10-RTCGGGATTAGCCAAGAGGTA Thaumatin-FCAAGCTTGTTGGGTCATCCT357DN828172Thaumatin like Thaumatin-RGTCCTCGAATGCAAGGGATA Glucanase-FCATTGATATGACCTTGATCG173CD486342Glucanase Glucanase-RGTGAGATATCCCTTGGATTG CAD1C-FATAAGGATGAAATGCGTCC433AF (+)-Delta- cadinene synthase CAD1C-RGAAGCTTGGTAAAGTTCCA LOX1-FGCATGGAGGACTGATGAAGAGTT1060AF361893Pathogen induced lipoxygenase LOX1-RGACTGGAAGGCTGAAGCCACCCATAT Chitinase-FACCAAGCTACTCGCAAGAGG156CD485880Chitinase Chitinase-RCGGAAGCGCAGTAAGATGA POD10-FCACTGTTTCCTGCGCTGATA413ES831865Peroxidase POD10-RCGAAACCATCAGGTGTTGTG MIC3-FTACCAAGGTGCTCCGGTAAC290GQ231922MIC3 MIC3-RGGGCTGAAGGATGCTCACTA GST13-FTTTTTGGATACTGGGCAAGC566DT464022Glutathione S-transferase GST13-RGCTGCAATTTGCGAAATCTT

2 Primer name Sequence 5`-3`cDNA Product size bp Accession number Gene OXRED-FAATTGAGTTCCCAGCCATT495CO123294Oxidoreductase OXRED-RTATTTCATCATCCGCACCAA MPD-FTGGACATAAGGGCAAAAAGG635CO118999Mevalonate Pyrophosphate Decarboxylase MPD-RTGCAAAATTAGCCTGTGCTG HIST3-FGAAGCCTCATCGATACCGTC412AF024716Histone 3 HIST3-RCTACCACTACCATCATGGC Table S1. (Continued)

3 Fig. S1. Disease severity in wild-type (WT) and transgenic cotton plants expressing AtNPR1 gene, one month following inoculation with Thielaviopsis basicola. The image shown is at the termination of experiment #2 conducted under growth chamber conditions.

4 ** Fig. S2. Resistance to Thielaviopsis basicola in transgenic cotton lines (#68L-19, #68L-20, and #68L-5) expressing AtNPR1. WT: wild-type. Shoot weight was used as a parameter to score disease-severity in experiment #2, conducted under growth chamber conditions, one month following inoculation with the pathogen. Data represent mean±SE, **P<0.01; n=10.

5 ** * * Fig. S3. Resistance to Thielaviopsis basicola in transgenic cotton lines (#68L-19, #68L-20, and #68L-5) expressing AtNPR1. WT: wild-type. Root weight was used as a parameter to score disease-severity in experiment #2, conducted under growth chamber conditions, one month following inoculation with the pathogen. Data represent mean±SE, *P<0.05, **P<0.01; n=10.

6 *** * Fig. S4. Resistance to Thielaviopsis basicola in transgenic cotton lines (#68L-19, #68L-20, and #68L-5) expressing AtNPR1. WT: wild-type. Chlamydospore count was obtained from the roots of WT and transgenic cotton plants, one month following inoculation with the pathogen in experiment # 2. Data represent mean±SE; *P<0.05, ***P<0.001; n=3; each replicate is a representative sample obtained from roots pooled from 3-4 infected plants.

7 WT 68L-20 WT 68L-20 Uninfected Infected Fig. S5. Stunting of growth caused by Thielaviopsis basicola in wild-type (WT) and transgenic cotton plants expressing AtNPR1 gene. The image depicted is of plants three months following inoculation with the pathogen from experiment #4 conducted under greenhouse conditions.


Download ppt "Table S1. List of primers used for the amplification of DNA fragments that were used as probes for Northern blot analysis. Primer nameSequence 5`-3`cDNA."

Similar presentations


Ads by Google