1. Protein Synthesis An intro to this section!

2. Transcription Making RNA from DNA 296-297; 300-303

3. Click for Animation

4. Let’s Draw it Out

6. Translation Forming polypeptides 297-300; 304-309 Interested in playing a game?

7. From your reading… How many total amino acids are there? How many bases (nucleotides) code for each amino acid? A triplet code known as a codon is found on what strand, DNA or RNA? What is a polypeptide chain made up of? Is the genetic code universal? (Do all organisms use the same codon/amino acid genetic code?) How does the above question relate to the linked history of the life on Earth?

8. From your reading… What type of RNA transfers amino acids from the cytoplasm to the ribosome? Where is tRNA made? Is tRNA reuseable? tRNA is a strand of RNA nucleotides, what is found at each of its ends? Wobble position=Not Needed Joining of amino acid to the tRNA is performed by what type of molecule? (Specific name is not needed)

9. From your reading… Where are the rRNA subunits made? The order of sites in the ribosome are E, P, A. P holds: A holds: E does what?: The movement of mRNA and tRNA through the sites requires energy from whom? What type of molecule is the release factor? Why are polyribosomes used?

10. Translation Converts/transfers information from mRNA into amino acids Amino acids are the monomers of proteins String amino acids together and a protein is made 3 RNAs needed – mRNA (messenger—from nucleus to ribosome) – rRNA (ribosomal—used in the ribosome) – tRNA (transfer—transfers the codons into amino acids using anticodons)

11. Translation 3 Main Steps 1.Initiation mRNA attaches to the ribosome (with the use of rRNA) rRNA reads the mRNA in groups of 3 nucleotides called codons Translation starts with a special codon – AUG—start codon—initiator

12. Translation 3 Main Steps 2. Elongation tRNA carries specific amino acid to the ribosome The specific amino acid is determined by the anticodon of tRNA The anticodon pairs with complementary codon on mRNA (Example: codon AUG; anticodon UAC) Peptide bonds form between amino acids, linking them into proteins tRNAs get recycled back to go pick up more amino acids

13. Translation amino acid tRNA **Draw this! anticodon codon protein (linked amino acids) ribosome

14. Translation 3 Main Steps 3. Termination Protein is released from ribosome when “stop codon” is reached – 3 stop codons: UAA UAG UGA

15. mRNA codon chart Let’s Try!! 1.If mRNA codon is CCG, what is the amino acid? 2.If tRNA anticodon is AAC, what is the mRNA codon? What is the amino acid? 3. If the DNA template strand is ATA, what is the mRNA codon? What is the amino acid? 1. 2. 3.

16. Translation Answers 1.Proline 2. UUG ; leucine 3.UAU ; tyrosine Now…. 1.Use codon chart to complete practice worksheet 2.Draw/analyze/explain Figures: 17.9 17.12 17.15 17.16 17.23

17. Click for Animation

20. Protein Synthesis DNA: TACACCTTCGCGCAATACTGC mRNA: AUGUGGAAGCGCGUUAUGACG AA: START-TRY-LYS-ARG-VAL-MET-THR START=METHIONINE