Download presentation
Presentation is loading. Please wait.
Published byArchibald White Modified over 9 years ago
1
Understanding the Etiology of Premature Rupture of Membranes Amy P. Murtha, MD Vice Chair for Research Obstetrics and Gynecology
2
Preterm Birth Preterm birth defined as delivery prior to 37 weeks gestation 11.9% of all deliveries in the US 500,000 pregnancies in the US per year More than newly diagnosed breast cancer cases
3
Preterm Birth in the US 14 12 10 8 6 4 2 0 1990199219941996199820002002200420062008 Year Late preterm (34 - 36 weeks) Early preterm (< 34 weeks) Preterm (< 37 weeks) 2011
4
Preterm Birth in the US Relative to the World – WHO Data* CountryPreterm Birth Rates Africa11.9 North America10.6 Asia9.1 Central America9.1 South America7.9 Australia/New Zealand6.4 Europe6.2 *Beck et al 2010: http://www.who.int/bulletin/volumes/88/1/08-062554/en
5
Preterm Birth in North Carolina National Center for Health Statistics, Final Natality Data
7
Preterm PROM Rupture of membranes prior to 37 weeks without labor 2-3% of all pregnancies are result of PPROM 20% of all perinatal deaths
8
PPROM Management 34-37 weeks Delivery <34 weeks Admitted for duration of pregnancy Monitored for evidence of infection or labor Clinical detection of infection limited Maternal fever increases risk of neonatal morbidity
9
Research Objectives Impact the management of PPROM Understand the etiology of PPROM
10
Biomarkers of Intrauterine Infection Prospective cohort study daily blood samples monitored for infection received antibiotics and steroids Subjects divided into those with and without funisitis (infection in umbilical cord)
11
PPROM Study Funisitis N=54 No Funisitis N=53 P value % Clinical Chorioamnionitis 22/54 (41%)1/49 (2%)<.0001 GA at delivery (wks) mean (SD) 28.5 (3.2)31.5 (2.6)<.0001 Birthweight (grams)1182 (516)1716 (547)<.0001 PPROM to delivery interval (mean days) 12.7 (10.3)16.4 (14.7).11
12
Median Serum IL-6 (pg/mL) Time pointFunisitis No FunisitisP value 24-48 hours7.5 (1.8–48.5) 2.8 (0.0–9.6) <.0001 48-72 hours5.3 (0.1-55.4) 1.5 (0.0-19.9) <.0001 >72 hours2.9 (0.1-42.0) 1.8 (0.0-22.4).03 24-72 hours5.3 (0.1-55.4) 1.9 (0.0-19.9) <.0001
13
Infection and Inflammation in Pregnancy Blood and Tissue Repository Over 400 subjects enrolled with over 4,000 samples collected 140 complete sets with daily blood samples collected Detailed delivery samples collected, barcoded and stored Maternal and cord blood, placenta, fetal membranes, umbilical cord, buccal swab
14
Understanding the Etiology of PPROM Mechanisms resulting in membrane thinning (weakening) Focus on the chorion cell layer Amnion Chorion Decidua
15
Etiology of PPROM Poorly understood and difficult to study Infection and inflammation important in development of PPROM
16
Fetal Chorion Layer Accelerated apoptosis in chorion layer Preterm and term in presence of histologic chorioamnionitis 1 Thinned or absent chorion among PPROM subjects 2 1 Murtha AP et al. Infect Dis Obstet Gynecol 2002;10:93–96 2 George RB et al. Am J Perinatol 2008;25:29–32
17
PPROM and the Chorion Amnion Chorion Amnion Chorion absent Normal PPROM
18
Moving forward…prospective collection Fetal membrane chorion thickness at membrane rupture distant from rupture Bacterial presence in fetal membranes membrane rupture distant from rupture Primary cell culture and cell line
19
Methods – Data Collection 46 paired membrane samples collected Rupture site (rupture) or overlying cervix Distant to rupture site (distant)
20
IHC Methods – Sample Processing Chorion and choriodecidual thickness measured using Image J ® software Chorion Choriodecidua
21
FISH Methods – Sample Processing Bacteria identified using fluorescence in situ hybridization (FISH) with Alexa Red probe to 16s rRNA subunit Custom oligonucleotide sequence 5´-F- ACTGCTGCCTCCCGTAGGAGTTTATTCCTT (Invitrogen®)
22
DistantRupture Chorion Term, No Labor 10X magnification
23
Distant Chorion Rupture PPROM 10X magnification
24
Chorion Thickness by Clinical Group Mean Thickness (µm) * ^ * P = 0.0024 ^ P = 0.0015
25
Number of Bacteria per Membrane Quadrant by Clinical Group *P < 0.0005 ^P = 0.002 Number Bacteria Per Quadrant ^ *
26
Number Bacteria per Membrane Quadrant Without Chorioamnionitis Number Bacteria Per Quadrant *P = 0.03^P = 0.006 N = 7N = 14N = 16 ^ *
27
What else…. Bacterial DNA sequencing from fetal membranes Ureaplasma parvum as a pathogen in pregnancy Thrombin’s role in fetal membrane integrity Cigarette smoke exposure and effect on membranes and placenta Progesterone’s role in modulating the inflammatory response MMP activity and regulation of progesterone Mechanisms of progesterone function through non- nuclear PR (PGRMC1)
28
Clinical Research in OB/GYN MFMU Clinical Trials Network (Federal) Antenatal Late Preterm Steroids (ALPS): A Randomized Placebo-Controlled Trial DMID vaccine trials (Federal) National Children’s study (Federal) Newborn Epigenetic Study (NEST) (Federal) Children’s Environmental Health Initiative (Federal) 17OH PC for Prevention of Recurrent Preterm Birth (Industry) Labor induction with misoprostil (Industry) Wound Vac in Obesity (Industry) Prenatal diagnosis with Maternal free fetal DNA (Federal/Industry) The effects of SCDs on fibrinolysis in patients undergoing Cesarean Delivery (Industry) A Prospective Study of the Hemostatic Differences between Women with and without Vaginal Bleeding in Pregnancy (Federal) An Intervention to Maximize Research Sample Collection for Pregnant Subjects at Delivery (Duke) Comparing Focused Ultrasound and Uterine Artery Embolization for Uterine Fibroids (Federal) Bridging Interdisciplinary Research Careers in Women’s Health (BIRCWH) K23 (Federal) Pelvic Floor Clinical Trials Network (Federal) Management of Menorrhagia in Women with Bleeding Disorders (Federal) Neural Prosthetic Control of Continence and Micturition (Federal) Effectiveness Of Sacrospinous Ligament Fixation (SSLF) versus Uterosacral Ligament Suspension (Federal) Cervical Intraepithelial Neoplasia Cohort Study (Federal) Ambulatory Treatments for Leakage Associated with Stress (Federal) Anticholinergic vs. Botox Comparison study: The ABC Trial (Federal) Outcomes Following Vaginal Prolapse Repair and Mid Urethral Sling (OPUS) Trial (Federal) Prospective randomized study of sperm production in healthy volunteers receiving pregabalin or placebo. (Federal/Industry) GIS Health Data in the Blanchard Neighborhood of Haiti: Assessment of Community Needs Guide Community Public Health Practice? (Foundation) Molecular Markers of Human Sperm Function (Federal)
30
Questions?
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.