2. The Pines October 28, 2013 Genomic Medicine A.Malcolm Campbell James G. Martin Genomics Program Director Professor of Biology, Davidson College

3. Outline of Talk 1.What is a genome? 2.How to sequence genomes? 3.Diagnose and Treat Cancers Better? 4.New Drugs from Failures: Iressa 5.New Treatment Paradigms 6.Gut microbiome

4. Science Presentation Give you the data, help you interpret.

5. What is a Genome?

6. Genetic information that you unique Human genome 3.4 billion base pairs G:C or A:T base pairs ~23,000 genes What is a Genome?

7. If the human genome were compiled in books: 200 volumes, 1000 pages each read 10 bases/second = 315,360,000 bases/year 9.5 years to read out loud (without stopping) What is the Human Genome?

8. Determine order of bases on all 23 (24) chromosomes Can only read 30 to 700 bases at a time Cannot sequence a genome in one run “Whole Genome Shotgun” sequencing How do you sequence a genome?

9. Determine order of bases on all 23 (24) chromosomes Can only read 30 to 700 bases at a time Cannot sequence a genome in one run “Whole Genome Shotgun” sequencing How do you sequence a genome?

10. Modern Genome Sequencing

11. This is an analogy for genome assembly. This page will be torn into horizontal strips. Modern Genome Sequencing

12. is an s an This i

13. Modern Genome Sequencing is a s an This i

14. Modern Genome Sequencing is a s an This i This is an analogy for genome assembly. This page will be torn into horizontal strips.

15. You don’t know the language or syntax.   

16. Huge Pile of Strips   

17. Needle in a Haystack?   

18. Reassemble the Tree from Paper

19. Modern Genome Sequence Assembly multiple copies of genome consensus genome sequence aligned sequencing reads

20. Modern Genome Sequence Assembly multiple copies of genome consensus genome sequence aligned sequencing reads

21. Modern Genome Sequence Assembly multiple copies of genome consensus genome sequence aligned sequencing reads high coveragelow coverage

22. Modern Genome Sequence Assembly multiple copies of genome consensus genome sequence aligned sequencing reads

23. Reference Genome Assembly ATGGCATTGCAA TGGCATTGCAATTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAATTTGAC ATGGCATTGCAATTT AGATGGTATTGCAATTTG

24. Reference Genome Assembly ATGGCATTGCAA TGGCATTGCAATTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAATTTGAC ATGGCATTGCAATTT AGATGGTATTGCAATTTG consensus AGATGGCATTGCAATTTGAC

25. 206 bones > 60 organs How do I remember them all?

26. 206 bones > 60 organs Think like a genomicist…

27. 1 – 22 + X & Y

28. Even Easier GCATGCAT

29. Is there a better way to diagnose and treat cancers?

30. Diffuse Large B Cell Lymphoma (DLBCL)

31. Diffuse Large B Cell Lymphoma (DLBCL) 25,000 new cases each year in America Half of patients die despite chemotherapy Why subject them to chemo if not helpful?

32. Who will benefit from chemotherapy? Brown and Botstein

33. Who will benefit from chemotherapy? control setpatient and control biopsies

34. Measure Gene Activity in All Cells

35. Characterize Cancers by Gene Activity

36. Retrospective Clinical Outcomes based on gene activity

37. Retrospective Clinical Outcomes based on gene activitytraditional prediction

38. Retrospective Clinical Outcomes wrong 27% wrong 32%

39. Retrospective Clinical Outcomes wrong 37%

40. Resort Low Risk Patients wrong 37% wrong 29%

41. Six Key Indicator Genes Genes On LMO2 BCL6 FN1 BCL2 SCYA3 CCND2 chemono chemo

42. Can Breast Cancer Treatment Be Improved?

43. tissue biopsies

44. Can Breast Cancer Treatment Be Improved?

45. No Patterns Emerged control setpatient biopsies

46. People Are More Unique Than Their Cancers before (BE) and after (AF) chemotherapy

47. Characterize Cancers by Personal Differences

49. “Breast Cancer” is a Misnomer

50. There are at least 5 Different Breast Cancers

51. No such thing as THE cure for cancer.

52. The Discovery of Iressa non-small cell lung cancer

53. Success from Failure: Iressa

54. Cancer Treatment from Nature’s Oddities Naked Mole Rat (NMR)

55. Face That Only A Mother Could Love

56. Face That Only A Mother Could Love?

57. Cancer Treatment from Nature’s Oddities lives 40 years never has cancer lives 4 years tumors common

58. high-molecular-mass hyaluronan (HA), What prevents cancer in naked mole rats?

59. 5 times bigger than human HA lower degradation rate than human What prevents cancer in naked mole rats?

60. HA Over Produced in NMR Tissues

63. relative amount of HA

64. Block HA  Tumors Form neg. control carcinogen 1 carcinogen 2 carcinogen 3 mouse cells NMR NMR - HA

65. neg. control carcinogen 1 carcinogen 2 carcinogen 3 NMR NMR - HAmouse cells Block HA  Tumors Form

66. neg. control carcinogen 1 carcinogen 2 carcinogen 3 NMR cells NMR - HAmouse cells Block HA  Tumors Form

67. neg. control carcinogen 1 carcinogen 2 carcinogen 3 NMR no HAmouse cells NMR cells Block HA  Tumors Form

68. Inject Mice with NMR Cells +/- HA tumors NMR cells ++ HAase NMR cells HA not made injectiontumorsrecipient mouse tumor

69. Inject Mice with NMR Cells +/- HA NMR cells ++ HAase NMR cells HA not made injectiontumorsrecipient mouse tumor

70. Inject Mice with NMR Cells +/- HA NMR cells ++ HAase NMR cells HA not made injectiontumorsrecipient mouse tumor

71. Inject Mice with NMR Cells +/- HA NMR cells ++ HAase NMR cells HA not made injectiontumorsrecipient mouse tumor

72. Inject Mice with NMR Cells +/- HA NMR cells ++ HAase NMR cells HA not made injectiontumorsrecipient mouse tumor

73. Inject Mice with NMR Cells +/- HA NMR cells ++ HAase NMR cells HA not made injectiontumorsrecipient mouse tumor

74. Inject Mice with NMR Cells +/- HA NMR cells ++ HAase NMR cells HA not made injectiontumorsrecipient mouse tumor

75. Inject Mice with NMR Cells +/- HA NMR cells ++ HAase mouse tumor NMR cells HA not made injectiontumorsrecipient

76. Cancer Treatment from Nature’s Oddities

77. Remember this next time Congress makes fun of scientists studying odd creatures.

78. Human Body Is Mostly Non-Human 50 trillion human cells

79. 500 trillion non-human cells Human Body Is Mostly Non-Human

80. 50 trillion human cells 500 trillion non-human cells 10% human, 90% bacterial Human Body Is Mostly Non-Human

81. Define the Human Microbiome 27 sites 9 adults 4 occasions

82. each sample colored by location clustered by similar species Define the Human Microbiome

83. Human Microbiome by Location

88. Two Types of Skin Habitats

89. Human Microbiome by Location

90. Human Microbiome Variations

92. Microbiome Transplant Experiments compare to transplants compare to natives

93. Human Microbiome Variations compare to transplants compare to natives

94. Human Microbiome Variations forearm sustains transplantsforehead replaces transplants

95. Human Microbiome many skin sites more diversity than gut high-diversity skin sites forearm palm index finger back knee sole of the foot

96. Myth Busters: dog’s mouth is really clean

98. mice fed low doses of antibiotics long term 15% more body fat than the control mice, Medical Uses of Microbiome

99. sequenced bacteria in stool samples humans 55 were thin 122 overweight or obese Medical Uses of Microbiome

100. obese people lack bacterial diversity in guts antibiotics reduce microbiome diversity Medical Uses of Microbiome

101. obese people lack bacterial diversity in guts missing microbes methane producers, “the carbon that does not get out as gas could be incorporated as fat.” Medical Uses of Microbiome

102. Using six species, predict obese 80% of the time Predictions based on genetics only 58% of the time Medical Uses of Microbiome

103. Guess what is being tested now…

104. fecal transplants

105. Thanks to my Colleagues Laurie Heyer Leland Taylor ‘12 supported by James G. Martin Genomics Program Davidson College