1. DNA, RNA, Mutations

2. Objective 2: 6a,b,c Biology: DNA, RNA, Mutation The student knows the structures and functions of nucleic acids in the mechanisms of genetics. The student is expected to: (A) describe components of deoxyribonucleic acid (DNA), and illustrate how information for specifying the traits of an organism is carried in the DNA; (B) explain replication, transcription, and translation using models of DNA and ribonucleic acid (RNA); (C) identify and illustrate how changes in DNA cause mutations and evaluate the significance of these changes

3. Remember THIS? Making a DNA copy of DNA is replication. Cells need to copy their DNA for mitosis (growth, repair, and maintenance). Daughter cells are genetically identical. DNA is also copied for meiosis (reproduction). Daughter cells are genetically different and have ½ the # of chromosomes. C P D C P D C P D P D G P D G P D T P D A P D T P D A P D G

4. Nitrogen Base Phosphate group Deoxy- ribose DNA is made of building blocks called nucleotides. They consist of a deoxyribose sugar, a phosphate group and a nitrogen base. The bases are adenine, thymine, guanine, and cytosine.

6. RNA is made of building blocks called nucleotides. They consist of a ribose sugar (instead of a deoxyribose sugar), a phosphate group and a nitrogen base. The bases are adenine, uracil, guanine, and cytosine. Nitrogen Base Phosphate group ribose

7. DNA RNA Both have adenine, guanine, and cytosine as bases Has the base thymine Has the base uracil Both have a sugar phosphate backbone. Sugar: Deoxyribose Sugar: ribose

8. There are three types of RNA: mRNA-messenger (transcribes DNA) tRNA-transfer (translates mRNA) rRNA-ribosomal (used as a machine for translation)

9. REPLICATION : DNA copies DNA A T G C http://www.johnkyrk.com/DNAreplication.html http://nobelprize.org/chemistry/educational/dna/b/replication/dna_c ompounds.html

11. TRANSCRIPTION: mRNA copies DNA A U G C TA http://www.johnkyrk.com/DNAtranscription.html

12. TRANSLATION: mRNA is decoded and a protein is made from amino acids. AU GC http://www.johnkyrk.com/DNAtranslation.html

13. MUTATION: Any change in the DNA sequence. If it is a point mutation (one letter is changed), it can change the amino acid sequence by changing the code. Deletion ATC ATG Point mutation

14. Transcription Translation DNA mRNAProtein In nucleus On ribosome Let’s try it: 1. Write this DNA base pair sequence on you paper. 2. Write the complementary strand of DNA that would bond to them. 3. Translate the strand into mRNA. 4. List the amino acids that these codons stand for. Use the amino acid chart on the next slide. ATGTGGCAG

16. A- T- G- T- G- G- C- A- G- Complementary strand that would form in Replication. T A C A C C C G T

17. T- A- C- A- C- C- G- T- C- AUGUGGCAGAUGUGGCAG DNA mRNA Amino Acids Methionine Tryptophan Glutamine TranscriptionTranslation Peptide Bonds

18. ATGCCATTCAATTAACCCTCC 1. Write this DNA base pair sequence on you paper. 2. Write the complementary strand of DNA that would bond to them. 3. Translate the strand into mRNA. 4. List the amino acids that these codons stand for.

19. DNA Original Strand ATGCCATTCAATTAACCCTCC DNA Replicated Strand TACGGTAAGTTAATTGGGAGG mRNAAUGCCAUUCAAUUAACCCTCC Amino Acids MetProPhenAspStop

20. DNA Simulation http://www.johnkyrk.com/DNAanatomy.html Interactive DNA Workshop http://www.pbs.org/wgbh/aso/tryit/dna/inde x.html