Presentation is loading. Please wait.

Presentation is loading. Please wait.

T-RFLP study of soil microbial community at elevated chloride concentration M. Gryndler Institute of Microbiology CAS, Prague In collaboration with: Miroslav.

Similar presentations


Presentation on theme: "T-RFLP study of soil microbial community at elevated chloride concentration M. Gryndler Institute of Microbiology CAS, Prague In collaboration with: Miroslav."— Presentation transcript:

1 T-RFLP study of soil microbial community at elevated chloride concentration M. Gryndler Institute of Microbiology CAS, Prague In collaboration with: Miroslav Matucha and Jana Rohlenová, Institute of Experimental Botany CAS, Prague and Jan Kopecký, Institute of Microbiology CAS, Prague

2 Questions: Does elevated Cl - concentration affect established soil microbial community? Does elevated Cl - concentration affect de- -novo developing microbial community? Which organisms are affected? Is a change in composition of soil microbial community followed by changes in degradation of chlorinated SOM or chlorination of SOM?

3 Methodology: Nonsterile or irradiated/recolonized 128 g soil samples, 20% humidity Podzolic O H soil from spruce monoculture Two levels of total soil Cl: 20 or 500 mg/kg Counting microbial CFU Extraction of DNA, TRFLP analysis of prokaryotic and eukaryotic ribotypes 14 C-TCA degradation 36 Cl - incorporation into humic substances

4 Design of the experiment (n=3) Low chloride, intact microflora High chloride, intact microflora Low chloride, sterilized/recolonized High chloride, sterilized/recolonized

5 Microbial CFU counts

6 DNA extraction (125 d) and amplification : Eubacteria Eukaryota Fungi Lanes 1,2,3 – 20N Lanes 4,5,6 – 500N Lanes 4,8,9 – 20S Lanes 10,11,12 – 500S Eukaryotic ITS region, Eubacterial SSU rDNA

7 Primers: Eubacteria: 16Seu27f, 783r-a,b,c (Sakai et al. 2004) Eukaryota: ITS1, ITS4 (White et al. 1990) Fungi: ITS1F, ITS4 (Gardes and Bruns 1993)

8 rDNA cassette 18S rDNA 5.8S rDNA 28S rDNA ITS1ITS2D1 D2 ITS1ITS4

9 TRFLP Terminal restriction fragment length polymorphism

10 Restriction cleavage Restriction profile

11 A B A+B

12 Restriction cleavage Restriction profile

13 Restriction cleavage Restriction profile

14 A B A+B

15 A B

16 Restriction cleavage: Taq I. restriction endonuclease for eukaryotic DNA ALU I. restriction endonuclease for eubacterial DNA Forward primers HEX-labeled Analysis using capillary electrophoresis, LIF detector

17 Terminal restriction fragments:

18 Numbers of TRF TreatmentSample Eubact.EukaryotaFungi 20N N S S

19 Effect of soil sterilization/recolonization: 3 eubacterial and 1 fungal TRF disappeared 1 eukaryotic and 1 fungal TRF detected

20 Effect of increased Cl - 1 eubacterial and 1 fungal TRF disappeared 1 bacterial and 1 eukaryotic TRF detected

21 Eukaryotic TRF 135 bp Absent from any treatment but nonsterilized soil high in chloride In 3 replicates constitutes 33.5, 11.4 and 7.0 molar % of all TRF !

22 Identity? Forward primer 5´- ITS TRF……....… T– 3´ 3´ stranded A GC– 5´ =TaqI Fragment lacks known reverse primer sequence Oligonucleotide adapter is necessary for PCR amplification

23 Identity? Forward primer 5´- ITS ……TRF………… T– 3´ 3´ stranded A GC– 5´ =TaqI Forward primer 5´- ITS TRF T/CG AAT TCT CCG TCT CGC TCC G – 3´ 3´ stranded A GC/TTA AGA GGC AGA GCG AGG C – 5´ =TaqI reverse primer

24 Identity? 5´ ‑ TCCGTAGGTGAACCTGCGGAAGGATCATTGGAGAGAGAAAG GGGGAGAGAGTTGGAATGTGATGAGACGAGAGATTCAAACT ATATAGTGAATGATCATACAACTGCTGACAATGGATCTCTGGG CTCTTGCGTCGAATTCTCCGTCTCGCTCCG-3´ This sequence is 100% identical with the sequence registered in GenBank under accession number DQ ("uncultured fungus isolate RFLP-145") and involves a part of 18S ribosomal RNA gene and a part of internal transcribed spacer 1. This sequence was amplified from DNA extracted directly from Ericaceous roots along a moorland-forest gradient in Scotland. At this stage, its identity is unknown (Prof. John W. G. Cairney, University of Western Sydney, Australia, personal communication).DQ309135

25 Identity? 5´ ‑ TCCGTAGGTGAACCTGCGGAAGGATCATTGGAGA GAGAAAGGGGGAGAGAGTTGGAATGTGATGAGAC GAGAGATTCAAACTATATAGTGAATGATCATACAA CTGCTGACAATGGATCTCTGGGCTCTTGCGTCG-3´ Sequence does not contain information sufficient to identify its bearer. However, it may be used to design specific primer to amplify larger rDNA fragments, perhaps suitable for identification by „BLASTing“

26 Primer CLF1 (forward) 5´-GAGTTGGAATGTGATGAGACG-3´ + Primer NL4 (reverse)

27 rDNA cassette 18S rDNA 5.8S rDNA 28S rDNA ITS1ITS2D1 D2 CLF1ITS4

28 ITS1F-ITS4 ITS1-ITS4 27f-783r CLF1-ITS4

29 rDNA cassette 18S rDNA 5.8S rDNA 28S rDNA ITS1ITS2D1 D2 CLF1 NL4

30 CLF1-ITS4/NL1-NL4 GAGTTGGAATGTGATGAGACGAGAGATTCAAACTATATAGTGAAT GATCATACAACTGCTGACAATGGATCTCTGGGCTCTTGCGTCGAT GAAGAACGCAGCAAAACGCGAAAAGTGTTATGATGTGCAGTCTT TGAGAATCATGAATGTTTGAACGCACCTTGCACCACCGAGCGATT GGGGGTATGCCTGTTTGAGCGGGGGATAAAATTGAGTGAACTGT GGTTTATTGTGGGGTACTAGGTAACACCTTGCCCTGAAAGACAGA TCTCGTGTACTCTTGGGATAATCCATCAAGAAGCACATTTACAGT ATACCACCTCAAATCAGGCAAGATGACCCGCTGAACTTAAGCAT ATCAGTAAGCGGAGGAAAAGAAACTAACCAGGATTCCCGCAGTA ACGGCGAGTGAAGAGGGAACAGCTCACATTTGGAAACGATCATG AAAAAAGTGGTCGAGTTGTCAGTGATAGCATGGGAGCGGGATTT GGAAAGGGTGAGCGAGTCTGCTGGAAAGCAGCGCCAGAGAGGG TGACAGCCCCGTGGCTTGCCTTGCACAAGTTTACGGAGCCATGC GACGAGTCGGACTGTTTGGGAATGCAGTCCTAAATGGGTGATAC GTGTCATCTAAAGCTAAATAGCGGCAAGAGACCGATAGCGAACA AGTACCGTGAGGGAAAGATGAAAAGAACTCTTGGCAGAGAGTGA AAAGTGCGTGAAATTGTCAGCAGGGAAGCGATGGTGGTGGGGA GGTGTGCCAAGAGAAGCAACTTCGTCAGAAGTTGCCAATTAAAA AGCACGAGCGAGGCGAGTGGATGAGGGGGAAGATAGGTGGGAA GAGAGAGTAATTCATTACAATTTCTTCAAACTAAACCCCCCACAC ACACCCACCTCGCAGCCCACCACGACCGACCCGTCTTGAAACAC GGACC

31 Homology? Glomus walkeri (AJ972467, E=1x ), Glomus drummondi (AJ970465, E=4x10 ‑ 36 ) Orpinomyces sp. (AJ864475, E=2x ) Entophlyctis sp. (DQ273782, E=6x ) Cyllamyces aberensis (DQ273829, E=2x ) Neocallimastix sp. (DQ273822, E=2x10 ‑ 35 )

32 Efects of increased chloride on organic and inorganic Cl - ?

33 36 Cl-TCA mineralization

34 Efects of increased chloride on organic and inorganic Cl - ?

35 Conclusions Sodium Chloride at „realistic“ concentrations affects soil microflora TRFLP and downstream techniques can be used to detect and identify organisms responding to chloride Inorganic and organic Cl behaviour is affected by Cl - concentration Links between specific organisms and soil Cl fluxes are probable


Download ppt "T-RFLP study of soil microbial community at elevated chloride concentration M. Gryndler Institute of Microbiology CAS, Prague In collaboration with: Miroslav."

Similar presentations


Ads by Google