Presentation is loading. Please wait.

Presentation is loading. Please wait.

Molecular Identification of Pathogens in Nursery Crops Ainong Shi Tennessee State University.

Similar presentations


Presentation on theme: "Molecular Identification of Pathogens in Nursery Crops Ainong Shi Tennessee State University."— Presentation transcript:

1 Molecular Identification of Pathogens in Nursery Crops Ainong Shi Tennessee State University

2 Lilac Leaf Blight What pathogen causes this disease? How to analyze and identify it by molecular approaches?

3 Powdery Mildew Diseases Dogwood Lilac Crape myrtle Are they caused by same pathogen? How to analyze and identify them by molecular approaches?

4 How to identify a pathogen by molecular approach? Lilac leaf blight for example 1

5 Molecular Identification of Pathogen ITS universal primer analysis Specific primer analysis

6 ITS (Internal Transcribed Spacer) 18S rDNA ITS1 5.8S rDNA 28S rDNA ITS2 ITS1 ITS4 (primer) ITS region of rDNA has been widely used in identifying pathogens for fungal diseases in plants. Thousands of sequences of ITS regions from fungi have been published in GenBank. Universal primer pairs can amplify ITS region for all fungi.

7 A four-step procedure PCR Product Sequencing ITS Universal Primer Analysis Similarity Analysis PCR Amplification DNA Extraction

8 Genomic DNA was extracted by use of the DNeasy Plant Mini Kit from Alternaria medium (mycelia and conidia) or directly from the lilac leaves of Alternaria leaf blight.

9 ITS universal primers: PCR Amplification 570 bp ITS1: tccgtaggtgaacctgcgg * IST4: tcctccgcttattgatatgc The primer pair ITS1/ITS4 produces a 570 bp fragment. ITS1/ITS4 * White, T. J., T. Bruns, S. Lee, and J. W. Taylor Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp In: PCR Protocols: A Guide to Methods and Applications.

10 PCR Product Sequence TCCGTAGGTGAACCTGCGG AGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGA ATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTG CAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAAT GCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATG CCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGT AATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTT TTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA GCATATCAATAAGCGGAGGA PrimerSequence (5’  3’)reversal sequence ITS1 TCCGTAGGTGAACCTGCGG IST4tcctccgcttattgatatgc GCATATCAATAAGCGGAGGA The sequence above amplified from the primer pair ITS1/ITS4.

11 Query: 1 tccgtaggtgaacctgcggagggatcattacacaaatatgaaggcgggctggaacctctc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 25 tccgtaggtgaacctgcggagggatcattacacaaatatgaaggcgggctggaacctctc 84 Query: 61 ggggttacagccttgctgaattattcacccttgtcttttgcgtacttcttgtttccttgg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 85 ggggttacagccttgctgaattattcacccttgtcttttgcgtacttcttgtttccttgg 144 …………………………………………………………………………………………………………………………………………………………… Query: 541 ctgaacttaagcatatcaataagcggagga 570 |||||||||||||||||||||||||||||| Sbjct: 565 ctgaacttaagcatatcaataagcggagga 594 BLAST Search Query – from our data Sbject – Alternaria in GenBank Similarity Analysis 570/570 (100%) identities Analysis indicates the sequence from our data belongs to ITS region of Alternaria.

12 Specific Primer Analysis  Develop specific primers for Alternaria genus.  Develop specific primers for A. alternata.

13 TCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTC GGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGG TGGGTTCGC CCACCACTAGGACAAACA TAAACCTTTTGTAATTGCAATCAGCGTCAGT AACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAA CGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA ACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCC TCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAG TAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAA AGGTCTAGCATCCATTAAGC CTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATA CCCGCTGAACTTAAGCATATCAATAAGCGGAGGA Primer design for ITS region of Alternaria PrimerSequence (5’  3’) Reversal sequence Al-f1cccaccactaggacaaaca Al-r1gcttaatggatgctagacct aggtctagcatccattaagc The sequence size from Al-f1 to Al-r1 is 370 bp.

14 Specific primer for Alternaria genus of ITS region The size of band is 370 bp. The band showed in all tested Alternaria samples. Sequence data from the PCR amplified from the specific primer pair Al-f1/Al-r1 is identical to that in ITS region of Alternaria. 370 bp The results indicated one kind of Alternaria was the pathogen.

15 Primer pair GenBank Accession Gene nameSequence results Lane above aa-endo-f1 aa-endo-r1 AY629233A. alternata endopolygalacturonase gene 100% (408/408) 1 to 4 aa-gp-f1 aa-gp-r1 AF282319A. alternata mixed-linked glucanase precursor 99% (659/664) 5 to 8 Specific primers for Alternaria alternata (1)

16 Primer pair GenBank Accession Gene nameSequence results Lane below aa-hsp-f1 aa-hsp-r1 AAU87808A. alternata hsp70 mRNA 100% (237/237) 1 & 2 aa-his-f1 aa-his-r1 AF404640A. alternata histone gene 100% (356/356) 3 & 4 Specific primers for Alternaria alternata (2) 1500 bp 1000 bp 600 bp 300 bp 100 bp M

17 Alternaria alternata is one pathogen in lilac leaf blight disease. Specific primer pairs: aa-gp-f1/aa-gp-r1 aa-hsp-f1/aa-hsp-r1 aa-hsp-f1/aa-hsp-r2 aa-his-f1/aa-his-r1 A. alternata Al-f1/Al-r1 Alternaria Conclusion for example 1

18 Powdery Mildew Diseases Dogwood Lilac Crape myrtle Are they caused by same pathogen? How to analyze and identify them by molecular approaches? Example two

19 Molecular Identification Approaches ITS universal primer analysis Sequence analysis Specific primer analysis

20 ITS universal primer analysis Disease Band sizeLane Crape myrtle powdery mildew 666bp1 Lilac powdery mildew 645bp2 Dogwood powdery mildew 642bp Primer pair: ITS1/ITS4 M 1 2 3

21 DiseasePrimer pair Sequence length CG%Pathogen Dogwood powdery mildew ITS1/ITS4642 bp54.05Erysiphe pulchra Lilac powdery mildewITS1/ITS4645 bp54.42Microsphaera syringae- japonicae Crape myrtle powdery mildew ITS1/ITS4666 bp51.05Uncinuliella australiana Sequence Analysis

22 Specific Primer Analysis I. Erysiphe pulchra of dogwood powdery mildew M M Lane 1, 4, 7 are Microsphaera syringae-japonicae Lane 2, 5, 8 are Erysiphe pulchra Lane 3, 6, 9 are Uncinuliella australiana Lane M are 100 bp ladder

23 Specific Primer Analysis II Uncinuliella australiana of powdery mildew in crape myrtle The bands only for U. australiana (lane 2, 6, 10, and 14) in four DNA groups: (1)Lagerstroemia indica, (2) Uncinuliella australiana, (3) Erysiphe Pulchra, and (4) Microsphaera syringae-japonicae. Lane M are 100 bp ladder. M M

24 Specific Primer Analysis III. Microsphaera syringae-japonicae of lilac powdery mildew M The band showed only for Microsphaera syringae-japonicae (lane 2) in three materials: 1. Erysiphe pulchra, 2. Microsphaera syringae-japonicae, and 3. Uncinuliella australiana. Lane M are 100 bp ladder

25 PathogenPrimer pairs ABCDEFGH Erysiphe pulchra Uncinuliella australiana Microsphaera syringae- japonicae A=EP-f6/EP-r3 B=EP-f6/EP-r4 C=EP-f6/EP-r5 Eight molecular markers (specific primer pairs) Summary for example 2 D=ua-f1/ua-r3 E=ua-f1/ua-r4 F=ua-f3/ua-r3 G=ua-f3/ua-r4 Primer pairs: H=msj-f2/msj-r1

26 Other diseases

27 Pseudocercospora bairamifera is one pathogen in lilac leaf spot. Lilac Leaf Spot

28 Identification of Botryosphaeria dothidea pathogen of leaf blight disease in dogwood (Cornus florida)

29 Oak Powdery Mildew

30 Maple Powdery Mildew

31 Similarity Analysis Molecular Detection of Pathogens PCR Product Sequencing PCR Amplification DNA Extraction Sequence to Verify Primer Test Specific Primer Design Pathogen Detection

32 Face to plant diseases How can we solve them? This is our JOB!

33 ACKNOWLEDGEMENTS Tennessee State University: Dr. Margaret Mmbaga, Dr. Sandra Reed, Dr. Nick Gawel, Dr. Roger Sauve, Dr. Suping Zhou, Dr. Emmanuel Nnodu, Dr. Frank Mrema, and Dr. Mario Keri.

34 Thank you! Thank all of you!


Download ppt "Molecular Identification of Pathogens in Nursery Crops Ainong Shi Tennessee State University."

Similar presentations


Ads by Google