Presentation is loading. Please wait.

Presentation is loading. Please wait.

Identification of a Ninth Foot- and-Mouth Disease Virus Type O Topotype and Evidence for a Recombination Event in its Evolution Nick J. Knowles, Paul R.

Similar presentations

Presentation on theme: "Identification of a Ninth Foot- and-Mouth Disease Virus Type O Topotype and Evidence for a Recombination Event in its Evolution Nick J. Knowles, Paul R."— Presentation transcript:

1 Identification of a Ninth Foot- and-Mouth Disease Virus Type O Topotype and Evidence for a Recombination Event in its Evolution Nick J. Knowles, Paul R. Davies, Rebecca J. Midgley and Jean-François Valarcher Institute for Animal Health, Pirbright Laboratory, Ash Road, Woking, Surrey, GU24 0NF, UK WRLFMD IAH


3 Previous studies Few studies on the European FMDV serotypes in Africa: Few studies on the European FMDV serotypes in Africa: –Knowles et al., 1998 (type A) –Samuel et al., 1999 (type O) –Samuel & Knowles, 2001 (type O) –Sangare et al., 2001 (type O) –Sahle et al., 2004 (type O) –Bronsvoort et al., 2004 (types O & A) Distinct genetic lineages of both FMDV-O and FMDV-A circulate in East and West Africa and viruses occurring in North Africa may be introduced from a variety of sources (Europe, South America, Middle East and West Africa). Distinct genetic lineages of both FMDV-O and FMDV-A circulate in East and West Africa and viruses occurring in North Africa may be introduced from a variety of sources (Europe, South America, Middle East and West Africa). Outbreaks of FMD types O and A in southern Africa are very rare and are usually introduced from outside the continent. Outbreaks of FMD types O and A in southern Africa are very rare and are usually introduced from outside the continent. WRLFMD IAH

4 FMDV O Topotypes - 2001 WRLFMD IAH Samuel, A.R. & Knowles, N.J. 2001. Foot-and-mouth disease type O viruses exhibit genetically and geographically distinct evolutionary lineages (topotypes). J. Gen. Virol. 82: 609-621.

5 RT-PCR & Sequencing AAAAAAAAAn LP1P2P3 5’ UTR3’ UTR VPg VP4VP2VP3VP12A2B2C3A3B3C 3D Poly C CapsidNon-structural proteins IRES WRLFMD Primers for RT-PCR an sequencing of FMDV O RNA. DesignationSequence (5' to 3') Genome location GenePosition within the gene O-1C244FGCAGCAAAACACATGTCAAACACCTTVP3244-269 O-1C272FTBGCRGGNCTYGCCCAGTACTACVP3272-294 O-1C283FGCCCAGTACTACACACAGTACAGVP3283-305 NK61GACATGTCCTCCTGCATCTG2B58-77 NK72GAAGGGCCCAGGGTTGGACTC2A/2B34-48; 1-6 O-1C499FTACGCGTACACCGCGTCVP3499-515 O-1C583FGACGGYGAYGCICTGGTCGTVP3583-602 NK61 O-1C244F O-1C272F O-1C283F IAH

6 VP1 (complete) WRLFMD IAH

7 VP1 (145-642) WRLFMD IAH

8 VP1 (478-642) WRLFMD IAH

9 Scanning analysis of VP1 WRLFMD IAH

10 Scanning analysis of VP1 WRLFMD IAH

11 Occurrence of FMDV O Topotypes in Africa WRLFMD IAH

12 FMDV O Topotypes - 2004 1% O/A/CHA/58 O1/Manisa/TUR/69 O/ALG/1/99 O/CIV/8/99 O/GHA/5/93 O/KEN/83/79 O/KEN/2/95 O/UGA/5/96 O/BUN/7/2003 O/KEN/5/2002 O/KEN/7/2002 O/KEN/3/2002 O/UGA/3/2002 O/MAL/1/98O/TAN/7/98 O1/Kaufbeuren/FRG/66 O3/VEN/51 O2/Brescia/ITL/47 O/ISA/1/74 O/JAV/5/72 O/ISA/1/62 O/ISA/9/74 O/ISA/8/83 O/HKN/14/82 O/PHI/7/96 O/TAW/81/97 O/CAM/2/98 O/VIT/7/97 O/TAI/4/99 O/IRQ/30/2000 East Africa 1 (EA-1) West Africa (WA) Middle East-South Asia (ME-SA) South-east Asia (SEA) Europe-South America (Euro-SA) Indonesia-2 (ISA-2) Indonesia-1 (ISA-1) Cathay East Africa 2 (EA-2) WRLFMD IAH

13 Future work We are completing the complete capsid sequencing of 9 African FMDV O isolates including representatives of all indigenous topotypes We are completing the complete capsid sequencing of 9 African FMDV O isolates including representatives of all indigenous topotypes We have an on-going study of FMDV O in Africa We have an on-going study of FMDV O in Africa We have completed a study of FMDV A in Africa (~80 VP1 sequences) We have completed a study of FMDV A in Africa (~80 VP1 sequences) IAH

14 Conclusions Two previously unrecognised genetic lineages of FMDV O were identified in East Africa, each having a distinct geographic distribution. Two previously unrecognised genetic lineages of FMDV O were identified in East Africa, each having a distinct geographic distribution. Recombination near the 3’ end of VP1 may have played a role in the evolution of the EA-2 topotype. Recombination near the 3’ end of VP1 may have played a role in the evolution of the EA-2 topotype. Alternatively, it may be that all the African lineages evolved after the introduction of Asian FMD viruses into Africa and more mutations have subsequently accumulated in certain parts of the capsid-coding region while other parts may have remained more conserved. Alternatively, it may be that all the African lineages evolved after the introduction of Asian FMD viruses into Africa and more mutations have subsequently accumulated in certain parts of the capsid-coding region while other parts may have remained more conserved. WRLFMD IAH

15 Recommendations Future phylogenetic analyses for molecular epidemiological purposes should be based on complete VP1 sequences. Future phylogenetic analyses for molecular epidemiological purposes should be based on complete VP1 sequences. More extensive molecular epidemiological studies of the European FMDV serotypes in Africa should be undertaken (this is in progress in our laboratory for serotypes O and A). More extensive molecular epidemiological studies of the European FMDV serotypes in Africa should be undertaken (this is in progress in our laboratory for serotypes O and A). More extensive genome analyses need to be performed to access the role of recombination in the natural evolution of FMD viruses. More extensive genome analyses need to be performed to access the role of recombination in the natural evolution of FMD viruses. WRLFMD IAH

16 Acknowledgements Nigel Ferris & Geoff Hutchings Nigel Ferris & Geoff Hutchings –for viruses Rahana Dwarka & Wilna Vosloo Rahana Dwarka & Wilna Vosloo –for sequences WRLFMD IAH

Download ppt "Identification of a Ninth Foot- and-Mouth Disease Virus Type O Topotype and Evidence for a Recombination Event in its Evolution Nick J. Knowles, Paul R."

Similar presentations

Ads by Google