Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E. 414-217-7784 What’s.

Similar presentations


Presentation on theme: "DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E. 414-217-7784 What’s."— Presentation transcript:

1 DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E What’s living in your water?™ Global Water Center, Milwaukee, WI

2 Company Introduction My Background o Professional Engineer – CH2M Hill o WEF Canham Graduate Studies Fellowship o NIH Biotechnology Training Program Fellow o PhD Candidate – Biotechnology Founded in 2012 to improve access to DNA sequencing services o Global Freshwater Seed Accelerator Winner o Rising Star Award - Early Stage Symposium Advisory Board - Current and former IWA presidents Key Developers - Biomolecular Engineer, Bioinformaticist Clients – CH2M Hill, Milwaukee Water, Consulting Firms

3 Current paradigm Problem: >99% of microbes can’t be cultured or identified under a microscope

4 Solution

5 DNA-Based Microbial Analysis Collect Environmental Sample (50mL sterile bottle) Sterilize, Preserve, Ship Add ethanol to 70% concentration to sterilize. Dilute with water to 25% for preservation and shipping (Shipping via Fedex: 5 days/$85USD/51GBP Concentrate Centrifuge or Filtration Extract DNA/Purify DNA Sequencing PCR Amplification/DNA Sequencing Assign Taxonomy (Proprietary) Bioinformatics/DNA Processing/Taxonomic Assignment Interpretation of Results (Proprietary) ATGCATT…... Nitrosomonas Healthy AOB population

6 Example DNA Data > TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTACGTAGG CGGACCCG TCAGTCAGTGGTGAAAGTTTGCAGCTTAACTGTAAAATTGCCATTGAAACT ACGGGTCTT GAGTGTAAATGAGGTAGGCGGAATGTGTTGTGTAGCGGTGAAATGCTTAGA TATAACACA GAACACCAATTGCGAAGGCAGCTTACTGGGATACAACTGACGCTGAGGCA CGAAAGCGTG GGGATCAAACAGG > TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAACGCAG GCTGGAGAT TAAGCGTGCTGTGAAATGTACCGGCTCAACCGGTGACGTGCAGCGCGAAC TGGTTTCCTT GAGTGAGTACGACGTCAGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGA TATCACGAA

7 Database of Wastewater Microbes (Proprietary)

8

9

10

11 Solution Cont’d Novelty o Economically feasible o Proprietary DNA databases and microbial knowledge Applications o Membrane Biofouling Troubleshooting o Wastewater Treatment Troubleshooting o Fecal Source Tracking o Drinking water distribution system monitoring and troubleshooting

12 Solution Cont’d Benefits o Wastewater Treatment Solve treatment problems Reduce energy and chemical consumption Maximise digester energy production Maximise effluent quality o Membrane Treatment Solve Biofouling issues Reduce chemical consumption Reduce operational and maintenance labor Increase membrane life o Drinking Water Solve taste/odor issues Solve coliform issues Ensure quality and safety Identify and fix distribution system issues

13 Case Studies

14 Membrane Biofouling

15 Membrane Biofouling Cont’d

16 Wastewater Treatment Municipal SBR – Filamentous Bulking in Spring SVI~300 Poor settling, poor effluent quality Potential to exceed permit TSS limit

17 Microscopy Results

18

19

20

21

22 Drinking Water Distribution System Case Study

23 Costs Project specific Membrane Biofouling o $2,000USD (1,200 GBP) analysis (save >$10,000 USD/6,000GBP in chemical/operational) Wastewater Treatment o $600USD (350 GBP) for 1 sample ($1000USD/600GBP) with microscopy) Drinking Water o Provide distribution system insurance for pennies per resident Business Model o Mail-in service business with additional consulting fee ($140/hr USD/85 GBP) o Return on investment can be extremely high

24 Status and Path Forward Currently serving clients in drinking water and wastewater Pilot studies o Wastewater Treatment Year-long pilot; weekly or monthly samples o Drinking Water Distribution System Single sampling event; collect samples from various locations in the distribution system Multiple cities to generate more data o Membrane Biofouling

25 Status and Path Forward Cont’d Plans o Pilot studies o Continue to serve clients and build our knowledge, refine our databases o Milwaukee distribution system project Support Needed o Wastewater Treatment Demonstration o Membrane Biofouling Demonstration o Drinking Water Distribution System Demonstration

26 Summary and next steps DNA analysis is economical o Superior to existing petri dish and microscopy methods Need partners to do more extensive pilot testing work and demonstrate results o Reduced energy and chemical consumption o Improved drinking water quality o Improved membrane performance

27 Thank You What’s living in your water? LinkedIn: Trevor Ghylin Global Water Center, Milwaukee, WI


Download ppt "DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E. 414-217-7784 What’s."

Similar presentations


Ads by Google