1. DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E. trevor.ghylin@microbedetectives.com 414-217-7784 www.microbedetectives.com What’s living in your water?™ Global Water Center, Milwaukee, WI

2. Company Introduction My Background o Professional Engineer – CH2M Hill o WEF Canham Graduate Studies Fellowship o NIH Biotechnology Training Program Fellow o PhD Candidate – Biotechnology Founded in 2012 to improve access to DNA sequencing services o Global Freshwater Seed Accelerator Winner o Rising Star Award - Early Stage Symposium Advisory Board - Current and former IWA presidents Key Developers - Biomolecular Engineer, Bioinformaticist Clients – CH2M Hill, Milwaukee Water, Consulting Firms

3. Current paradigm Problem: >99% of microbes can’t be cultured or identified under a microscope

4. Solution

5. DNA-Based Microbial Analysis Collect Environmental Sample (50mL sterile bottle) Sterilize, Preserve, Ship Add ethanol to 70% concentration to sterilize. Dilute with water to 25% for preservation and shipping (Shipping via Fedex: 5 days/$85USD/51GBP Concentrate Centrifuge or Filtration Extract DNA/Purify DNA Sequencing PCR Amplification/DNA Sequencing Assign Taxonomy (Proprietary) Bioinformatics/DNA Processing/Taxonomic Assignment Interpretation of Results (Proprietary) ATGCATT…... Nitrosomonas Healthy AOB population

6. Example DNA Data >594682 TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTACGTAGG CGGACCCG TCAGTCAGTGGTGAAAGTTTGCAGCTTAACTGTAAAATTGCCATTGAAACT ACGGGTCTT GAGTGTAAATGAGGTAGGCGGAATGTGTTGTGTAGCGGTGAAATGCTTAGA TATAACACA GAACACCAATTGCGAAGGCAGCTTACTGGGATACAACTGACGCTGAGGCA CGAAAGCGTG GGGATCAAACAGG >594511 TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAACGCAG GCTGGAGAT TAAGCGTGCTGTGAAATGTACCGGCTCAACCGGTGACGTGCAGCGCGAAC TGGTTTCCTT GAGTGAGTACGACGTCAGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGA TATCACGAA

7. Database of Wastewater Microbes (Proprietary)

11. Solution Cont’d Novelty o Economically feasible o Proprietary DNA databases and microbial knowledge Applications o Membrane Biofouling Troubleshooting o Wastewater Treatment Troubleshooting o Fecal Source Tracking o Drinking water distribution system monitoring and troubleshooting

12. Solution Cont’d Benefits o Wastewater Treatment Solve treatment problems Reduce energy and chemical consumption Maximise digester energy production Maximise effluent quality o Membrane Treatment Solve Biofouling issues Reduce chemical consumption Reduce operational and maintenance labor Increase membrane life o Drinking Water Solve taste/odor issues Solve coliform issues Ensure quality and safety Identify and fix distribution system issues

13. Case Studies

14. Membrane Biofouling

15. Membrane Biofouling Cont’d

16. Wastewater Treatment Municipal SBR – Filamentous Bulking in Spring SVI~300 Poor settling, poor effluent quality Potential to exceed permit TSS limit

17. Microscopy Results

22. Drinking Water Distribution System Case Study

23. Costs Project specific Membrane Biofouling o $2,000USD (1,200 GBP) analysis (save >$10,000 USD/6,000GBP in chemical/operational) Wastewater Treatment o $600USD (350 GBP) for 1 sample ($1000USD/600GBP) with microscopy) Drinking Water o Provide distribution system insurance for pennies per resident Business Model o Mail-in service business with additional consulting fee ($140/hr USD/85 GBP) o Return on investment can be extremely high

24. Status and Path Forward Currently serving clients in drinking water and wastewater Pilot studies o Wastewater Treatment Year-long pilot; weekly or monthly samples o Drinking Water Distribution System Single sampling event; collect samples from various locations in the distribution system Multiple cities to generate more data o Membrane Biofouling

25. Status and Path Forward Cont’d Plans o Pilot studies o Continue to serve clients and build our knowledge, refine our databases o Milwaukee distribution system project Support Needed o Wastewater Treatment Demonstration o Membrane Biofouling Demonstration o Drinking Water Distribution System Demonstration

26. Summary and next steps DNA analysis is economical o Superior to existing petri dish and microscopy methods Need partners to do more extensive pilot testing work and demonstrate results o Reduced energy and chemical consumption o Improved drinking water quality o Improved membrane performance

27. Thank You What’s living in your water? trevor.ghylin@microbedetectives.com 414-217-7784 www.microbedetectives.com www.microbedetectives.com LinkedIn: Trevor Ghylin Global Water Center, Milwaukee, WI