Presentation is loading. Please wait.

Presentation is loading. Please wait.

2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes.

Similar presentations


Presentation on theme: "2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes."— Presentation transcript:

1

2 Genetic Engineering Biotechnology

3 (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes from one organism, or the manufacture of genes, in order to place them in another organism (often of a different species) such that the receiving organism expresses the gene product; (e) describe how sections of DNA containing a desired gene can be extracted from a donor organism using restriction enzymes; (i) explain how isolated DNA fragments can be placed in plasmids, with reference to the role of ligase; (j) state other vectors into which fragments of DNA may be incorporated; (k) explain how plasmids may be taken up by bacterial cells in order to produce a transgenic microorganism that can express a desired gene product; (l) describe the advantage to microorganisms of the capacity to take up plasmid DNA from the environment; (m) outline how genetic markers in plasmids can be used to identify the bacteria that have taken up a recombinant plasmid;

4 We have been manipulating DNA for generations!  Artificial breeding  creating new breeds of animals & new crop plants to improve our food

5 Animal breeding

6 Breeding food plants  “Descendants” of the wild mustard  the “Cabbage family”

7 Breeding food plants Evolution of modern corn (right) from ancestral teosinte (left).

8 A Brave New World

9 The code is universal  Since all living organisms…  use the same DNA  use the same code book  read their genes the same way

10 TACGCACATTTACGTACGCGGATGCCGCGACTATGA TCACATAGACATGCTGTCAGCTCTAGTAGACTAGCT GACTCGACTAGCATGATCGATCAGCTACATGCTAGC ACACYCGTACATCGATCCTGACATCGACCTGCTCGT ACATGCTACTAGCTACTGACTCATGATCCAGATCAC TGAAACCCTAGATCGGGTACCTATTACAGTACGATC ATCCGATCAGATCATGCTAGTACATCGATCGATACTG CTACTGATCTAGCTCAATCAAACTCTTTTTGCATCAT GATACTAGACTAGCTGACTGATCATGACTCTGATCC CGTAGATCGGGTACCTATTACAGTACGATCATCCGAT CAGATCATGCTAGTACATCGATCGATACTGCTACTGA TCTAGCTCAATCAAACTCTTTTTGCATCATGATACTA GACTAGCTGACTGATCATGACTCTGATCCCGTAGAT CGGGTACCTATTACAGTACGATCATCCGATCAGATC ATGCTAGTACATCGATCGATACT human genome 3.2 billion bases

11 Can we mix genes from one creature to another? YES!

12 Mixing genes for medicine…  Allowing organisms to produce new proteins  bacteria producing human insulin  bacteria producing human growth hormone

13 How do we do mix genes?  Genetic engineering  find gene  cut DNA in both organisms  paste gene from one creature into other creature’s DNA  insert new chromosome into organism  organism copies new gene as if it were its own  organism reads gene as if it were its own  organism produces NEW protein: Remember: we all use the same genetic code!

14 Cutting DNA  DNA “scissors”  enzymes that cut DNA  restriction enzymes  used by bacteria to cut up DNA of attacking viruses  EcoRI, HindIII, BamHI  cut DNA at specific sites  enzymes look for specific base sequences GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA GTAACG|AATTCACGCTT CATTGCTTAA|GTGCGAA

15 Restriction enzymes  Cut DNA at specific sites  leave “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site

16 Sticky ends  Cut other DNA with same enzymes  leave “sticky ends” on both  can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA

17 Sticky ends help glue genes together TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA gene you wantcut sites AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA chromosome want to add gene tocut sites AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene sticky ends chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC sticky ends stick together DNA ligase joins the strands Recombinant DNA molecule

18 Why mix genes together? TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC  Gene produces protein in different organism or different individual aa “new” protein from organism ex: human insulin from bacteria human insulin gene in bacteria bacteriahuman insulin How can bacteria read human DNA?

19 Uses of genetic engineering  Genetically modified organisms (GMO)  enabling plants to produce new proteins  Protect crops from insects: BT corn  corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)  Extend growing season: fishberries  strawberries with an anti-freezing gene from flounder  Improve quality of food: golden rice  rice producing vitamin A improves nutritional value

20 Bacteria  Bacteria are great!  one-celled organisms  reproduce by mitosis  easy to grow, fast to grow  generation every ~20 minutes

21 Bacterial DNA  Single circular chromosome  only one copy = haploid  no nucleus  Other DNA = plasmids! bacteria chromosome plasmids

22 There’s more…  Plasmids  small extra circles of DNA  carry extra genes that bacteria can use  can be swapped between bacteria  bacterial sex!!  rapid evolution = antibiotic resistance  can be picked up from environment

23 How can plasmids help us?  A way to get genes into bacteria easily  insert new gene into plasmid  insert plasmid into bacteria = vector  bacteria now expresses new gene  bacteria make new protein + transformed bacteria gene from other organism plasmid cut DNA recombinant plasmid vector glue DNA

24 Grow bacteria…make more grow bacteria harvest (purify) protein transformed bacteria plasmid gene from other organism + recombinant plasmid vector

25 Applications of biotechnology

26 Outline the use of genetic markers  HGH gene inserted into plasmids that are resistant to certain antibiotics, for detail review p. 167 of OCR Biology 2.  How ever, are there possible ‘issues’ with this type of marker DISCUSS.  Suggest possible alternative marker… .. Insert a gene that cause fluorescence from jellyfish.

27 I’m a very special pig! Got any Questions?


Download ppt "2006-2007 Genetic Engineering Biotechnology (c) define the term recombinant DNA; (d) explain that genetic engineering involves the extraction of genes."

Similar presentations


Ads by Google