Presentation is loading. Please wait.

Presentation is loading. Please wait.

2007-2008 Biotechnology A Brave New World Practical DNA Technology Uses Forensics – Sequencing DNA of crime suspects Diagnosis of disease – DNA screening.

Similar presentations


Presentation on theme: "2007-2008 Biotechnology A Brave New World Practical DNA Technology Uses Forensics – Sequencing DNA of crime suspects Diagnosis of disease – DNA screening."— Presentation transcript:

1

2 Biotechnology

3 A Brave New World

4 Practical DNA Technology Uses Forensics – Sequencing DNA of crime suspects Diagnosis of disease – DNA screening for diseases Human gene therapy – Replacing absent or faulty DNA with normal, working DNA Pharmaceutical products (vaccines) Transgenic organisms – Animals Mice with human genes for animal testing Livestock with extra copies of growth hormone genes to improve food supply Chicken with a gene resistant to the bacteria that causes food poisoning – Plants 52% of soybeans and 25% of corn in U.S. are transgenic.

5 Complete in chromosomes 3.2 billion DNA base pairs 19,599 protein-coding sections – Genes make up 2% of Human DNA 98% of DNA is non-coding – Entire function is still unknown, but does play a role in gene regulation Human Genome Project Mapping the Human Genome

6 Cloning is a term that refers to making a genetically identical copy. Cells and Tissues can be cloned. Organism cloning (also called reproductive cloning) refers to making a new multicellular organism, genetically identical to another. Cloning

7 How to Clone Take a donor’s egg and remove the nucleus. Insert a nucleus from the targeted individual’s diploid cell.

8 Dolly In 1996, Ian Wilmut cloned Dolly from an adult sheep.

9 CopyCat In February 2002, researchers from Texas A & M reported the live birth of a cloned tabby. Researchers are interested in using cloned cats in AIDS research, since feline AIDS is a good model for human AIDS.

10 Noah (Ox Cloned in a Cow) in 2001

11 PCR Polymerase Chain Reaction – method for making many, many copies of a specific segment of DNA – ~only need 1 cell of DNA to start

12 PCR process In tube: DNA, DNA polymerase, primer, nucleotides Denature DNA: heat (90°C) DNA to separate strands Anneal DNA: cool to hybridize with primers & build DNA (extension) What does 90 0 C do to our DNA polymerase?

13 The polymerase problem 90°C heat destroys DNA polymerase Need enzyme that can withstand 90°C… – Taq polymerase (Thermus aquaticus) from hot springs bacteria

14 A PCR is run four times; each time with a different dideoxynucleotide, or “ddNTP,” which lack the 3'- hydroxyl group. Whenever a ddNTP is incorporated into a growing DNA chain, it stops chain growth. The resulting pieces can be analyzed for length to determine the sequence of the DNA. Sequencing DNA

15 Restriction enzymes Cut DNA at specific sites – leave “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site

16 Sticky ends Cut other DNA with same enzymes – leave “sticky ends” on both – can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA

17 Process of DNA Fingerprinting First restriction enzymes cut the DNA into fragments The DNA fragments are separated fragments by size with Gel Electrophoresis

18 Gel electrophoresis DNA is negatively charged When it’s in an electrical field it moves toward the positive side small pieces travel farther large pieces travel slower + – DNA         “swimming through Jello”

19 Gel Electrophoresis longer fragments shorter fragments power source completed gel gel DNA & restriction enzyme wells - +

20 Uses: Evolutionary relationships Comparing DNA samples from different organisms to measure evolutionary relationships – + DNA  turtlesnakeratsquirrelfruitfly

21 Uses: Medical diagnostic Comparing normal allele to disease allele chromosome with disease-causing allele 2 chromosome with normal allele 1 – + allele 1 allele 2 DNA  Example: test for Huntington’s disease

22 Pre-Implantation Genetic Diagnosis (PGD) Removing a cell for diagnosis from a human embryo.

23 Amniocentesis and Chorionic Villus Sampling Many new techniques for learning about individual genes rather than whole chromosomes are available or under development.

24 Uses: Paternity Who’s the father? + DNA  childMomF1F2 –

25 Uses: Forensics Comparing DNA sample from crime scene with suspects & victim – + S1 DNA  S2S3V suspects crime scene sample

26 0.1% of 3 billion base pairs is still 30 million. The protein-coding sections of our DNA may lose their function if sections are repeated. However, the non-coding sections of DNA can contain several short (2-4 bases) repeats called Short Tandem Repeats (STR). The number of repeats changes the length of DNA. Any two humans have 99.9% similar DNA Forensic DNA fingerprinting

27

28 Differences at the DNA level Two sections of “junk” DNA GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA 3 Repeats 6 Repeats

29 Allele 1 GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA repeats DNA patterns for DNA fingerprints cut sites GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA 123 DNA  –+ allele 1 Cut the DNA

30 Allele 1 GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Differences between people cut sites DNA  –+ allele 1 Allele 2: more repeats GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA DNA fingerprint allele 2 123

31 RFLPs Restriction Fragment Length Polymorphism – differences in DNA between individuals  change in DNA sequence affects restriction enzyme “cut” site  creates different fragment sizes & different band pattern Alec Jeffries 1984

32 RFLP / electrophoresis use in forensics 1st case successfully using DNA evidence – 1987 rape case convicting Tommie Lee Andrews “standard” semen sample from rapist blood sample from suspect How can you compare DNA from blood & from semen? RBC?

33 Electrophoresis use in forensics Evidence from murder trial – Do you think suspect is guilty? “standard” blood sample 3 from crime scene “standard” blood sample 1 from crime scene blood sample 2 from crime scene blood sample from victim 2 blood sample from victim 1 blood sample from suspect OJ Simpson N Brown R Goldman

34 Bacterial genome Single circular chromosome – haploid – ~4 million base pairs 1/1000 DNA in eukaryote How have these little guys gotten to be so diverse??

35 Plasmids Small supplemental circles of DNA ,000 base pairs self-replicating – carry extra genes 2-30 genes genes for antibiotic resistance – can be exchanged between bacteria bacterial sex!! – can be imported from environment

36 Plasmids help us get new genes into bacteria Insert new gene into plasmid Insert plasmid into bacteria = vector bacteria now expresses new gene and makes new protein + transformed bacteria gene from other organism plasmid cut DNA recombinant plasmid vector glue DNA DNA  RNA  protein  trait

37 Grow bacteria…make more grow bacteria harvest (purify) protein transformed bacteria plasmid gene from other organism + recombinant plasmid vector

38 Plasmids are also used to genetically engineer multicellular organisms Plasmids are DNA vectors Genes must be inserted into the zygote to change the traits of a multicellular organisms. DNA combined from different sources is called Recombinant DNA An organism with Recombinant DNA is called Transgenic

39 p-GLO Gene The gene that makes jellyfish glow has been isolated and inserted into other organisms.

40

41

42 Uses of genetic engineering Genetically modified organisms (GMO) – Protect crops from insects: BT corn corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) – Extend growing season: fishberries strawberries with an anti-freezing gene from flounder – Improve quality of food: golden rice rice producing vitamin A improves nutritional value

43 Gene Therapy Problem (disease-causing) genes can be removed and replaced with normal genes.


Download ppt "2007-2008 Biotechnology A Brave New World Practical DNA Technology Uses Forensics – Sequencing DNA of crime suspects Diagnosis of disease – DNA screening."

Similar presentations


Ads by Google