Presentation is loading. Please wait.

Presentation is loading. Please wait.

Assessment: Designing your classes for meaningful learning Presented by Jenny Frederick, Yale University Based on materials developed by: Jenny Knight,

Similar presentations

Presentation on theme: "Assessment: Designing your classes for meaningful learning Presented by Jenny Frederick, Yale University Based on materials developed by: Jenny Knight,"— Presentation transcript:

1 Assessment: Designing your classes for meaningful learning Presented by Jenny Frederick, Yale University Based on materials developed by: Jenny Knight, UC-Boulder Michelle Withers, WVU, Clarissa Dirks, Evergreen State U.

2 Why do science instructors need assessment? A.To find out what students have learned B.To find out what students haven’t learned C.To find out what students are confused about D.A-C are correct E.Can she use that word in public?

3 Learning Outcomes You will be able to... Distinguish between summative and formative assessment Use Bloom’s Taxonomy to evaluate assessments Use the principles of backward design to align learning outcomes with formative and summative assessments Demonstrate different possible uses of formative assessments

4 Think-Pair-Share How do you know when you know something? How do you know when your students know something? How do your students know when they know something? Buzzword: Metacognition

5 Formative: in class or before end of a unit (quiz, homework) Summative: at the end of a unit or course (exam, final project)

6 THE MONTILLATION AND USES OF TRAXOLINE It is very important to learn about traxoline. Traxoline is a new form of zionter. It is montilled in Ceristanna. The Ceristannians found that they could gristerlate large amounts of fervon and then bracter it to quasel traxoline. This new, more efficient bracterillation process has the potential to make traxoline one of the most useful products within the molecular family of lukizes snezlaus. QUIZ: 1. What is traxoline? 2. Where is it montilled? 3. How is traxoline quaseled? 4. Why is traxoline important? Exams communicate what instructor finds important If you test students on fact-based knowledge, that is what they will study!

7 Misconceptions exercise If a camera crew making a documentary on student misconceptions questioned your students at the end of your course, what would you be most embarrassed to find out that they didn’t know? (Shout out your ideas) Some objectives may be content-independent! (see Vision and Change)

8 Backward Design: Outcomes drive assessment and instruction What should students know or be able to do by the end of your course? How will you know if they get there? What will you do to get them there? Learning goalsAssessmentsLearning activities Know your objective: Bloom’s taxonomy can help

9 Pick the answer that best describes your understanding of Bloom’s taxonomy: A.I know it and use it in my teaching B.I have heard of it before C.It’s not at all useful to me D.Bloom’s what?

10 Bloom’s Taxonomy, 1956 HOCS LOCS *H/LOCS = higher/lower order cognitive skills

11 LEVELTERMS USEDPCR EXAMPLE Remembering: can the student recall or remember the information? define, duplicate, list, memorize, recall, repeat, reproduce, state. What does PCR stand for? What enzyme is used in PCR? Understanding: can the student explain ideas or concepts? classify, describe, discuss, explain, identify, locate, recognize, report, select, translate, paraphrase Draw out one cycle of PCR. Applying: can the student use the information in a new way? choose, demonstrate, dramatize, employ, illustrate, interpret, operate, schedule, sketch, solve, use, write. Given this genetic sequence, design primers for your PCR. Analyzing: can the student distinguish between the different parts? appraise, compare, contrast, criticize, differentiate, discriminate, distinguish, examine, experiment, question, test. Given these starting conditions and these results, explain what happened. Evaluating: can the student justify a stand or decision? appraise, argue, defend, judge, select, support, value, evaluate Discuss the advantages and disadvantages of reverse transcriptase PCR for quantifying gene expression levels. Creating: can the student create new product or point of view? assemble, construct, create, design, develop, formulate, write. Design a PCR method for adding a tag to your target gene.

12 At what Bloom’s level do you expect your students to perform? Do your exams demonstrate higher order cognitive skills? What do authentic scientists practice? Refer to Bloom’s handout when designing assessments

13 Alignment: example (handout) Learning or Course Goal Outcome or Objective (content + behavior) Summative Assessment (exam question) Formative Assessment (in class activity) What will students learn? If they have learned it, what will students know and be able to do? How will students demonstrate they know it or are able to do it? What will students do to learn it? Students will understand the transfer of information from DNA to proteins Students will predict the new amino acid sequence that results from a mutation in a given gene sequence Students are given sequence of DNA and corresponding amino acid sequence. Students identify reading frame and predict amino acid changes due to mutations in that sequence Students will be able to predict changes in amino acid sequences caused by mutations

14 Backward design in action Each group will choose1 learning objective (samples provided) As a group: 1.Come up with an activity your students could do (formative assessment) to help them achieve this objective 2.Write an exam question for this objective (summative assessment) 3.Determine the Bloom’s level of the exam question

15 “Ongoing assessment plays a key role – possibly the most important role – in shaping classroom standards and increasing learning gains.” Black and Wiliam, 1998

16 Formative assessments help students… Confront misconceptions Figure out what they know & don’t know (metacognition!) Construct new knowledge …and instructors gauge progress in learning

17 Pick the answer that best describes your understanding of Bloom’s taxonomy: A.I know it and ways to use it in my teaching B.I have heard of it before C.It’s not at all useful to me D.Bloom’s what?

18 Recap: Learning Outcomes You are now able to... Distinguish between summative and formative assessment Use Bloom’s Taxonomy to evaluate assessments Use the principles of backward design to align learning outcomes with formative and summative assessments Demonstrate the different possible uses of formative assessments


20 What % of higher order Bloom’s level questions would you expect to find on an typical intro bio exam? A.0-20 B C D E

21 Zheng et al., 2008 Science VOL 319

22 Formative assessments have multiple roles in the classroom 1. Assessments help confront misconceptions (Example method: clicker)

23 As the acorn grows into the tree, from where does the majority of the biomass come? A.Air B.Soil C.Water D.Sun What do you do if students get this wrong?

24 2. Assessments help students distinguish between what they know and what they don’t know. Example method: Group Brainstorm

25 Genetic diseases, like Phenlyketonuria (PKU), confirm that there is a link between an individual’s DNA and that individual’s proteins. Below is a DNA molecule and the amino acid sequence that would result from translating the DNA sequence. 3’CGTTTTACCAAACCGAGTACTGAG 5’GCAAAATGGTTTGGCTCATGACTC TRP-PHE-GLY-SER As a group, write down what you know about DNA and proteins on one side of the white board. On the other side, write what else you need to know to be able to answer this question. Which nucleotides are responsible for this particular sequence of amino acids?

26 3. Assessments can aid construction of new knowledge Example method: Group work followed by report-out

27 Based on your understanding of natural selection and traits that vary along a continuum, 1.Explain the changes that occurred in the tree and dinosaur populations over time. 2.Create a graph of the offspring’s height vs mother’s height of the original population, and the next three generations. (AAAS 1999) These represent the average for an entire population What level Bloom’s is this question? a.Higher order b.Lower order c.In between d.I need a coffee break

28 4. Assessments allow students and instructors to gauge students’ progress during learning. Example methods: clicker with peer discussion and revote problem solving with group participation

29 dominant recessive Imagine that earlobe attachment is dictated by a single gene (a simplification), yielding two traits: unattached and attached. Unattached earlobes are due to the dominant allele (top picture) Attached earlobes are due to the recessive allele (bottom picture) From this information, you can conclude: a.Attached earlobes are seen less frequently than unattached earlobes in a population b.Attached earlobes are seen more frequently than unattached earlobes in a population c.Either phenotype could be seen more frequently in a population: you need more information InitialAfter discussion Clicker example

30 Darwin at the Olympics (For this exercise, pretend you are a student who is just learning about natural selection) Work with your group to modify the 100-meter dash such that it would become an example of natural selection. Brainstorming/group work example I’ll write your ideas on the flip chart when you’re ready Which are actual examples of natural selection, and why?

31 Reading assessment: Scientific Teaching, Chapter 3

32 Tools to EnGauge Students: Group Exercise Pick one misconception for your group 1.Design a formative assessment to gauge student understanding of it 2.Write an exam question that will evaluate Feel free to use Bloom’s handout

33 We can do better! Set meaningful learning objectives Design aligned assessments Execute fabulous (and aligned) active learning formative assessments

Download ppt "Assessment: Designing your classes for meaningful learning Presented by Jenny Frederick, Yale University Based on materials developed by: Jenny Knight,"

Similar presentations

Ads by Google