Presentation is loading. Please wait.

Presentation is loading. Please wait.

WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert for Detection of MTB and Rifampin Resistance David Warshauer, PhD, D(ABMM) Deputy Director, Communicable.

Similar presentations


Presentation on theme: "WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert for Detection of MTB and Rifampin Resistance David Warshauer, PhD, D(ABMM) Deputy Director, Communicable."— Presentation transcript:

1 WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert for Detection of MTB and Rifampin Resistance David Warshauer, PhD, D(ABMM) Deputy Director, Communicable Diseases Wisconsin State Laboratory of Hygiene 1

2 WISCONSIN STATE LABORATORY OF HYGIENE HEALTHYPEOPLE

3 14-14 Reduce TAT for laboratory Dx Target:2 days for 75% [21 days // 96] U.S. Department of Health and Human Services, January 2000

4 WISCONSIN STATE LABORATORY OF HYGIENE Percentage of Culture-Confirmed Pulmonary TB Cases Detected by NAAT in Wisconsin ( )

5 WISCONSIN STATE LABORATORY OF HYGIENE FDA-Cleared Molecular TB Tests FDA-Approved TB Molecular Assays for Respiratory Specimens Amplified M. tb Direct Test® (MTD): Gen-Probe, Inc. Cepheid GeneXpert ®

6 WISCONSIN STATE LABORATORY OF HYGIENE Nucleic Acid Amplification Tests Commercial tests available outside US BD ProbeTec MTB Direct Detection COBAS® Amplicor® MTB Test COBAS® TaqMan® MTB Test Hain Genotype® Mycobacteria Series Innogenetics INNO-LIPA TM Laboratory Developed Tests Off-label use of FDA-approved tests

7 WISCONSIN STATE LABORATORY OF HYGIENE 7 Courtesy Angela Starks, CDC

8 WISCONSIN STATE LABORATORY OF HYGIENE Use of NAAT by US Public Health Laboratories in 2008 – Starks et al. [CDC] 104,425 suspect TB patients 92,877 – not tested88% 12,548 – tested12% NAR2010 – P 77 5,855 from Florida

9 WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert System Cepheid, Sunnyvale, CA RT-PCR, < 2 hours Potential for point of care testing

10 WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert MTB/RIF Assay Automated commercial system for identification of M. tuberculosis complex and detection of rifampin resistance Decontamination, digestion, DNA extraction, amplification, and detection in same cartridge Integrated positive control assures that a negative result is not due to NAA inhibitors in the specimen Results in ~2 hours Minimal hands on manipulation- technically simple Platform is random access 10

11 WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert Target: rpoB gene Nested PCR and molecular beacon technology Same segment of the rpoB gene is used for detection of both M. tb complex and rifampin resistance PCR amplifies a small region relevant for rifampin resistance; uses 5 probes to assess for mutations

12 WISCONSIN STATE LABORATORY OF HYGIENE 12

13 WISCONSIN STATE LABORATORY OF HYGIENE GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTG TCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG 507 rpoB 533 ** * * * ** * * * ** * 81 base pair core region * * ** * ** * * * * ** * * * ** Insertion TTC Insertion TTCATG Deletion CCATTC Deletion GGCACC Del AAC Deletion CAGAAC Deletion GACCAG Deletion AATTCATGG Deletion GAACAA Genetics of Rifampin Resistance in M. tuberculosis Adapted from Ramaswamy & Musser Tubercule Lung Dis 79:3 13

14 WISCONSIN STATE LABORATORY OF HYGIENE M. Tb Complex PCR for All

15 WISCONSIN STATE LABORATORY OF HYGIENE finddiadnostics.org

16 WISCONSIN STATE LABORATORY OF HYGIENE Example of Rif-Sensitive Profile – 5 probes are positive MTB/Rif Assay design Molecular Beacon Target Hybrid Each probe is labeled with a different fluorophore, permitting simultaneous detection of the presence of wild type. The MTB assay target is the 81 bp region (RRDR) of the rpoB gene. SPC 16

17 WISCONSIN STATE LABORATORY OF HYGIENE 17 Challenges to Implementing NAAT Guidelines MTD: $30/test Cepheid: $78/test (includes equipment & service [lease or cash] & kit) Gen-Probe® MTDCepheid® MTB/RIF Reagents 2 controls 3 patients $240 3 inhib ctrl 3 patients $234 Labor ($20/hr) 2 hrs $ 4010 min $ 3 Direct costs per patient result $ 93 $ 79 Courtesy Ken Jost, Texas SPHL

18 WISCONSIN STATE LABORATORY OF HYGIENE Cepheid Limit of detection – 131 CFU/ml M. tuberculosis viability – minus 8 log 107 clinical specimens/suspicion of TB – Vietnam –100% - 29/29AFB + / Culture + –84.6% - 33/39AFB- /solid Culture + –71.7% - 38/53AFB- / solid & broth Culture Helb et al. JCM 48: (2010)

19 WISCONSIN STATE LABORATORY OF HYGIENE Cepheid Boehme et al NEJM Assessed Xpert MTB/RIF in 1730 patients –Peru –Azerbaijan –South Africa –India Both suspected drug-sensitive and multidrug-resistant pulmonary TB Boehme, C.C. et al. NEJM 363: , 2010

20 WISCONSIN STATE LABORATORY OF HYGIENE Boehme et al Among AFB smear pos/culture pos patients –Single Direct MTB/RIF identified 98.2% (551/561) Among AFB smear neg/culture pos –72.5% (124/171) –Addition of a second MTB/RIF increased sens to 85.1% –Addition of a third increased sens to 90.2% Specificity > 98.1%

21 WISCONSIN STATE LABORATORY OF HYGIENE Rifampin Resistance Boehme et al Detection of rifampin resistance –Sensitivity of 99.1% (209/211) –Specificity of 100% (506)

22 WISCONSIN STATE LABORATORY OF HYGIENE Xpert Detection of Mtb in Pulmonary TB 22

23 WISCONSIN STATE LABORATORY OF HYGIENE Rifampin Resistance Detection in Pulmonary TB 23 Chang, K. Journal of Infection (2012) pp 1-9

24 WISCONSIN STATE LABORATORY OF HYGIENE Expert Performance in HIV Coinfected Population 24 Chang, K. Journal of Infection (2012) pp 1-9

25 WISCONSIN STATE LABORATORY OF HYGIENE Xpert Performance Breakdown 25 Chang, K. Journal of Infection (2012) pp 1-9

26 WISCONSIN STATE LABORATORY OF HYGIENE 2009 CDC Recommendations for use of NAAT NAAT should be performed on at least one respiratory specimen from each patient with signs and symptoms of pulmonary TB for whom a diagnosis of TB is being considered but has not yet been established, and for whom the test result would alter case management or TB control activities NAAT as standard practice MMWR, 2009, 58:7-10

27 WISCONSIN STATE LABORATORY OF HYGIENE CDC Algorithm Collect at least one respiratory specimen, preferably the first, for NAAT Collect additional specimens for smear and culture Must interpret NAAT results in correlation with the AFB smear results

28 WISCONSIN STATE LABORATORY OF HYGIENE First Respiratory Specimen Smear NegativeSmear Positive NAAT Positive: Presumed TB, Pending culture results Negative Use clinical judgment to determine whether to begin therapy while awaiting culture results and determine if additional diagnostic testing is needed. If a second specimen is smear positive, NAAT negative. the patient is presumed to have an infection with non-tuberculous mycobacteria, pending culture results, Consider testing another specimen (not to exceed a total of two). NAAT Positive: A patient can be presumed to have tuberculosis, pending culture results, if two specimens are NAA positive. Positive Negative Consider testing another specimen (not to exceed a total of two). Inhibitors Detected: Test result is of no diagnostic help. Consider testing second specimen (not to exceed a total of two). Use clinical judgment to determine whether to begin therapy while awaiting culture results and determine if additional diagnostic testing is needed. Use clinical judgment to determine whether to begin therapy while awaiting results of culture and other diagnostic tests. Currently available NAA tests are not sufficiently sensitive to exclude the diagnosis of TB in AFB smear negative patients suspected of having TB.

29 WISCONSIN STATE LABORATORY OF HYGIENE Who should be tested? CDC recommends NAAT on first sputum of all patients SUSPECTED of TB for whom the test result would alter case management or TB control activities –NAAT should NOT be ordered routinely when clinical suspicion of TB is low. Definition of a suspect case can vary among clinicians Clinicians, TB programs, and laboratorians must collaborate to develop criteria/definition for patients to be tested

30 WISCONSIN STATE LABORATORY OF HYGIENE Wisconsin criteria for NAAT Signs and symptoms Risk factors Patient in airborne isolation Reported to local health department as a suspect case At WSLH all initial smear positive respiratory specimens automatically tested with NAAT

31 WISCONSIN STATE LABORATORY OF HYGIENE NAAT for release of patients suspected of pulmonary TB from Isolation CDC Expert panel recommendations –Sputum that is NAAT negative and 2 additional sputums that are AFB smear negative. Collected at 8-24 hour intervals, at least one of which is an early morning specimen –Should not be used when suspicion for TB is high enough to start TB medications. Clinical response, usually 4-7 days treatment, and 3 smear negative sputums 31

32 WISCONSIN STATE LABORATORY OF HYGIENE Summary Advantages of NAAT –More rapid diagnosis –Initiation of earlier treatment –Cost savings with reduced patient isolation –Faster reporting to TB Programs –Fewer transmissions

33 WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert Will make NAAT more widely available to suspect TB patients –Earlier diagnosis –Approach 2020 goal Will provide rapid detection of rifampin resistance and possible MDR-TB cases –Caveat---In population with low prevalence of rifampin resistance, predictive value will be poor (approx 56%) 33

34 WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert NAAT is a supplemental test –Does not replace AFB smear and culture –Smear needed for interpretation –Culture still the Gold Standard for TB diagnosis In a low TB prevalence population, most smear positive specimens will be NTMs 34

35 WISCONSIN STATE LABORATORY OF HYGIENE Research Needs for Future Advancements Studies to develop, evaluate, and select the most effective and efficient NAAT and culture algorithms Develop better tests for non-respiratory specimens Develop tests with improved performance and ease-of-use Develop tests that will enhance the diagnosis of TB in children Develop multiplex assays that can detect M. avium complex, M. kansasii and other NTM Develop tests to detect resistance to both first and second line drugs Develop tests that can be used in resource limited countries. Requires ease of use and low cost.

36 WISCONSIN STATE LABORATORY OF HYGIENE Thank You


Download ppt "WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert for Detection of MTB and Rifampin Resistance David Warshauer, PhD, D(ABMM) Deputy Director, Communicable."

Similar presentations


Ads by Google