Presentation is loading. Please wait.

Presentation is loading. Please wait.

¿Es hereditario el cáncer? Javier Benítez Dpto. Genética Humana CNIO.

Similar presentations


Presentation on theme: "¿Es hereditario el cáncer? Javier Benítez Dpto. Genética Humana CNIO."— Presentation transcript:

1 ¿Es hereditario el cáncer? Javier Benítez Dpto. Genética Humana CNIO

2 Cancer incidence in spain (Cases /year) LocationMale Female Total Lung Colorectal Breast Stomach Bladder Prostate From IARC 2.000

3 Cáncer esporádico Cáncer familiar

4 ¿ Por qué es importante el asesoramiento genético? 5% de los cánceres pueden ser hereditarios Implicaciones sociales, familiares, individuales Importante la identificación y selección de familias a riesgo para: - Asesorar - Estudiar - Prevenir

5 46 cromosomas genes millones de bases

6 Guanina (G) Citosina (C) Siempre se une a Adenina (A) Siempre se une a Timina (T) AGCTATGC TCGATACG Proteína SerStop C Arg G

7 Un Gene es un segmento de DNA que da lugar a una proteína. Gen #1Gen #2Gen #3 Anticuerpo Insulina Colágeno

8 La variación genética contribuye a las diferencias interindividuales. PERO, cambios en genes críticos dan lugar a mutaciones

9 Cáncer de mama: La población Judía presenta una deleción de dos bases (del185AG) en un alto porcentaje ATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGG CCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACC AATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGA AGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTT TCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAAAGCAG ACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGAGGA CGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACA TGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAG TATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAA ATAAGTATTGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAA GACTTGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGG GCTAATCTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGT CTTGCCCTTTTTCAGGCTGGGCTAGGGAGAATGATGATGAAGTACAGAGATCAGAGA CTGGGAAGATCAGTGAAAGACTTGTGATTACCTCAGAAATGATTGAAAATATCCAAT TGTTAAGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAAAACTTAAGACA ACAGAACTGAAACTGACTCGGAAGGCAGCCTATGTGAGATACTTCAATAGCTCAGCC TCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTATCTGTGCTTCCCTATGCACTAATCA AGGAATCATCCTCCGGAAAATATTCACCACCATCTCATTCTGCATTGTTCTGCGCAT GCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCA TAAACAAAATACAGGATTTCTTACAAAAGCAAGAATATAAGACATTGGAATATAACT AACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAGGGATTTGG GAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAATGGTGAT ACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTA TTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAA ACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAG ACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTA AGAAAATATCAT TGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAA GCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTT GAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGAG AGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGT TTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACT GGATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTT GCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCC GACTTTAGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGA GAAATTCAATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTG CTCCTGGACAGAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAA AGGAAGAATTCTATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAA AGACTCCCTTACAAATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAA GCTGTCCTTAGTACCAGATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGT ATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATG CACACTCAGTTAACCAAGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAA AGTGTCACTGGCCCCTCAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTT

10

11 Cancer Mama - BRCA1/2 mutación: 80% probabilidad de desarrollar la enfermedad - BRCA1/2 normal: 10% probabilidad de desarrollar la enfermedad

12 1.5 millones de nucleotidos delecionados en Neurofibromatosis - +

13 6 ó más manchas café con leche Nodulos de Lisch en iris Múltiples neurofribromas

14 Genes identificados Enfermedad Gen Año Cromosoma RetinoblastomaRb8613 T. WilmsWT9011 NeurofibromatosisNF19017 FAC poliposisAPC91 5 S. Li-FraumeniP E. TuberosaET9416 Ca. MamaBRCA19613 BRCA29717 MEN1MEN19711 Ca. GástricoCDH19816 S. Cowden PTEN9910 FeocromocitomaSDHD0011 SDHC01 1

15 Cáncer familiar z Alrededor de un 5% de los cánceres z Edad temprana de aparición z Afectación de órganos pares/multifocalidad z Acumulo de un mismo tipo de cáncer en la familia

16 Hereditary cancer-example

17 Benefits of the genetic test Identification of carriers Rationalise clinical exploration Design of new strategies for early detection and follow-up

18 Limitation and application of the genetic test Technical limitations Meaning of a positive /negative result Psychological impact Information privacy Clinical management

19 ? ??? ? ? Li-Fraumeni syndrome Gullet Ca. 51y. Breast cancer 22y. Astrocytoma 33y. Osteosarcoma 17y. Pleural Mesotelioma 34y. Bilateral colobome 4y. P53 carrier Non carrier

20

21 35a. 30a. 35a. 46a. Family with hereditary breast cancer

22 Familial breast cancer About 10% of women will develop breast cancer 5% will be hereditary BRCA 1/2 are the responsible genes The identification of these families is important for GC

23 Genetic counseling 25% high risk families associated to BRCAs Variable penetrance: 60-80% for Br % for Ov. 10% for males High risk for other cancers: Bilateral Br. 50% Ov. 30% Prostate 20% Others

24 Surveillance in at risk women Annual mamography and clinical examination around 35 years old Surgery: - Oophorectomy Breast cancer (50%) - Mastectomy Breast cancer (90%) - Contralateral breast surgery: 5 years better than 10 years since the first Br Ca (12% vs 40%) Oral contraceptivesOvarian risk (TMX)BRCA + ??

25 Hereditary nonpolyposis colorectal cancer (HNPCC) Accounts for 5% - 10% of all bowel cancers Autosomal dominant Penetrance as high as 85% - 90% Colon cancer at young mean age of 45y. 70% right sided cancers

26 Colorectal cancer Colonoscopy: from years/every 2 or 3 years Ca125 (endometrium): from 30-35y/every 1 or 2 years Gastroscopy: from y/every 1 or 2 years

27 z Cáncer familiar z Ca páncreas z Ca testículo z Ca pulmón z Ca próstata* z Ca renal células claras z E.Hodgkin SCF sin genes conocidos o con modelo de herencia desconocido

28 t(3;8) CN Nódulo renal benigno ? RCC células claras RCC papilar Linfoma C. Mama t(3;8) CN Cáncer renal de células claras (RCC) hereditario CN Cariotipo normal

29 Agregación familiar 40 a Dx.71a Ca. Mama bilateral Dx. 60 a Ca. Laringe Dx. 20 a Ca. Faringe Dx. 80 a Ca. Mama Dx. 42 a Ca. mama Dx. 63 a Ca. Próstata Dx. 60 a Ca. Pulmón Dx. 36 a Ca. Testiculo RM Ceguera

30 à 48 a Melanoma Dx. 72 a Ca. Mama (45-55) à 53 a Ca. Colon à 55 a Ca. Tiroides à 59 a Ca. Mama Múltiples cánceres

31 Un 5-10% del cáncer es familiar Es importante conocer si el probandus pertenece a una familia a riesgo Es importante realizar estudios predictivos Se puede evitar el desarrollo de un tumor. Conclusiones


Download ppt "¿Es hereditario el cáncer? Javier Benítez Dpto. Genética Humana CNIO."

Similar presentations


Ads by Google