1. Translation What is the Genetic Code, and how is it read? – Our 1 st step Understanding Vocabulary – Define & Draw these… – Polypeptide-- Genetic Code – Codon--Translation – Anticodon-- Gene Expression – Amino Acid-- Heredity

2. Protein Synthesis mRNA to Protein Translation

3. Key Question As a group, try to figure out this key question: – What is meant by “The Genetic Code,” and how is it “read”?

4. Translation What is Translation = What is The Genetic Code – Language of 4 letters in 3-letter words. Called Codons

5. Translation How many codons are possible? – 64

6. Translation What do codons code for? – Code for Amino Acids

7. Translation As a group, complete the following: – Be ready to talk about this and possibly draw a diagram of your answer: What is the Process of Translation? Where does Translation occur? Who are the “major players” of translation and what are their roles?

8. Translation Where does Translation always start? – Start Codon AUG is always the Start Codon Corresponds with Met (Methionine) Where does Translation end? – Stop Codons UAA, UAG, UGG Why are these stop codons? – Don’t correspond with any Amino Acid

9. Translation Review so far: Where does Translation Occur? – Ribosome What does the Ribosome do? – Uses the sequence of mRNA codons to assemble Amino Acids into Polypeptide Chains (Proteins) How do Ribosomes do this? – Lets look at this…

10. Steps of Translation Depending on the textbook, there are 5-6 steps of translation: – What are the steps of translation? Draw a picture representing each step…

11. Steps of Translation Lettuce Review… Step 1 mRNA attaches to Ribosome Ribosome reads Start Codon

12. Steps of Translation Step 2 Ribosome brings in appropriate tRNA – How does this happen?

13. Steps of Translation Step 2 cont. tRNA – Shaped specifically Anticodon – – mRNA attachment site – Complimentary sequence to mRNA codon Amino Acid site

14. Steps of Translation Step 3 Ribosome completes it’s structure Ribosome has 3 Important Sites…

15. Steps of Translation Ribosome Structure – A site Active Site – – Where “reading” occurs – P Site Peptide Site - – Where amino acids are joined together – E Site Exit Site - – Where “empty” tRNA’s leave to get more amino acids

16. Steps of Translation Step 4 Ribosome Moves & reads next codon Ribosome brings in Appropriate AA. Called = Elongation

17. Steps of Translation Step 5 Peptide bond is formed Ribosome reads next codon Releases 1 st tRNA

18. Steps of Translation Step 6 Step 4 & 5 are repeated until Termination

19. Heredity Gene Expression – The Central Dogma of molecular biology is: Information is transferred from DNARNAProtein – Proteins are the “Workers” of organisms Produce pigment enzymes that control reproduction – Proteins are: Microscopic tools, each specifically designed to build or operate a component of a living cell Important players in producing an organism’s traits

20. How Does a Cell Interpret Codons? Write the following gene on your paper. TACGACAAGTCCACAATCCAT 1.From Left to Right, write the sequence of the mRNA molecule transcribed from this gene. 2.Translate the mRNA into it’s tRNA sequences. 3.Using the table of anti-codons, write the amino acid sequence. 4.Repeat step 3, reading the codons from right to left. 5.Analyze & Conclude: 1.Why did steps 3 & 4 produce different polypeptides? 2.Do cells usually decode mRNA’s in one direction only or in either direction?

21. tRNA anti-codons

22. Translation Review 1.How does a cell interpret the genetic code? 2.What are codons and anticodons? 3.Using the table of anti-codons, identify the amino acids specified by the codons UGG, AAG, and UGC 4.What happens during translation? 5.How is protein synthesis different then DNA replication? 6.Why is the genetic code considered universal? 7.What does the term gene expression mean? 8.In what way does controlling the proteins in an organism control the organisms characteristics? Due Friday 5/10 Answers will be posted on the PEP server after the due date. Complete on a Separate Piece of Paper