Download presentation
Published byArron Horn Modified over 9 years ago
1
The Case of the Druid Dracula: Clicker Case Version
by Norris Armstrong, Terry Platt, and Peggy Brickman Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching in Science, University at Buffalo, State University of New York.
2
In this case, students learn:
the basic structure of DNA, including that DNA molecules are composed of two chains. that the two nucleotide strands in a DNA chain: are complementary to each other (A-T, G-C); have distinct 5! end and 3! ends; and have opposite polarity (anti-parallel). how DNA is replicated, including: the major enzymes involved in replication and the functions of these enzymes; that during replication, each DNA strand can serve as a template for production of a new complementary DNA strand that scientists can mimic the mechanism to replication to copy particular pieces of DNA using the process of polymerase chain reaction (PCR). how DNA sequences can vary from one person to the next, including that: short-tandem repeats (STRs) are stretches of repeated nucleotide sequences that vary between chromosomes; the probability that a particular combination of STRs might exist in an individual just by chance can be estimated statistically; and scientists can identify individuals by examining these differences in DNA sequence.
3
Misconceptions DNA strands do not have a distinct polarity. The techniques used by scientists to study DNA are unrelated to processes seen in living organisms when in reality these often either use or mimic strategies used by living cells
4
The Crime In a quiet corner of Wales in the village of Llanfairpwll, 90-year-old Mabel Leyshorn was murdered. Her murder had been not only brutal (her heart had been hacked out), but also creepy. It appeared as if the Mabel’s blood had been collected in a small kitchen saucepan and tasted. The murder showed other signs of the occult: a candlestick and a pair of crossed pokers had been arranged near the body. - from BBC’s Crimewatch December 2001
5
The Crime Scene Further investigation indicated that this was no supernatural villain at work: the murderer had worn tennis shoes which had left distinctive footprints under the glass door that had been shattered by a piece of broken garden slate. Moreover, the windowsill had bloodstains on it; with any luck, the evidence recovery unit hoped to use it to help determine who had committed the crime.
6
CQ1: What is your blood type?
A: A B: B C: AB D: O E: Don’t know
7
Evidence in the Courtroom
Blood was previously used for blood typing Now used as source of DNA Sources of DNA? Uses for DNA fingerprinting Primarily rape cases Paternity testing Historical/missing persons investigations Military “dog tag” Convicted felon databases
8
individual nucleotides
DNA in the Cell chromosome double stranded DNA molecule Target Gene individual nucleotides
9
Example: Amelogenin Gene
Tooth enamel development Copies on X and Y chromosome X copy is different from Y copy --- indicates missing bases X copy is shorter than Y copy 5’CCCTAGGGTCTATAACGCCTAGTGTGTTGATTC 5’ 3’GGGATCCCAGATATTGCGGATCACACAACTAAG 3’ Y: X: 5’CCCTAGGGTCTA GTGTGTTGATTC 5’ 3’GGGATCCCAGAT CACACAACTAAG 3’ GTGTGTTGATTC 3’ CACACAACTAAG 5’
10
Gel Electrophoresis: Sizing DNA Fragments
(-) Negative electrode (+) Positive electrode bp?
11
CQ2: The DNA fragment indicated is approximately ____ base pairs in size.
bp?
12
Why do the two DNA fragments indicated differ in how bright they appear?
13
DNA Structure Two DNA chains Complementary Antiparallel 5′ end 3′ end
14
5’-CCCTGGGCTCT-3’ A: 3′ -ACTGTTAGATT-5′ B: 3′ -GGGACCCGAGA-5′
CQ3: Below is one strand from part of the amelogenin gene. What is the nucleotide sequence of the other strand? 5’-CCCTGGGCTCT-3’ A: 3′ -ACTGTTAGATT-5′ B: 3′ -GGGACCCGAGA-5′ C: 5′ -GGGACCCGAGA-3′ D: 3′ -CCCTGGGCTCT-5′ E: 5′ -CCCTGGGCTCT-3′
15
Copying DNA (Replication)
DNA strands are separated A T C G T - T A G C - A T C G - T A G C A T C G - T A G C A - - G Each single strand is used as a template to make a complementary strand A - C - T - Two identical DNA molecules are produced
16
Enzymes Perform Replication
Helicases unwind DNA double helix. Single Stranded Binding Proteins hold separated DNA strands apart. Primase makes a starting point (primer). DNA polymerase connects new complementary bases. Ligase attaches pieces together.
17
Enzymes Perform Replication
Replication fork
18
CQ4: How would DNA replication be affected if ligase were not available?
A: The template strands would not be able to separate. B: Replication would result in many small segments of DNA instead of a complete molecule. C: Complementary RNA would be produced but not complementary DNA. D: The DNA strands would separate but replication would not be able to start. E: The DNA strands produced by replication would not be complementary to the template strands.
19
Amplifying DNA with PCR (Polymerase Chain Reaction)
Target region Thermal cycle Thermal cycle Thermal cycle In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created
20
CQ5: You need many copies of the amelogenin gene, which you will make using Polymerase Chain Reaction (PCR). You will need to follow the steps of replication. Which of the following would allow you to begin? A: Add short stretches of single stranded DNA complementary to the sequence at either end of the gene. B: Add DNA polymerase enzyme. C: Break the covalent bonds that hold the double helix together. D: Break the hydrogen bonds that hold the double helix together.
21
CQ6: Which of the strands of DNA could act as a primer for the DNA sequence shown below?
5’-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3’ 3’-GGGACCCGAGACATTTACAAAGATTCAC-5’ A: 3′ -ACTGTTAGA-5′ B: 3′ -AAATTTGGC-5′ C: 3′ -ATGCTTTGA-5′ D: 5′ -GGGACCCGA-3′ E: 5′ -CCCTGGGCT-3′
22
Automated gels 110 bp 101 bp MW Amelog.
23
CQ7: The blood left at the crime scene was from a male
CQ7: The blood left at the crime scene was from a male. Which of the following DNA profiles could have come from the suspect? A: B:
24
CQ8: Is this enough to convict a suspect?
A: Yes B: No
25
Additional Markers Short Tandem Repeats (STRs)
---TCAT--- Chromosomes 11 of suspect 1: Same pair in suspect 2: Different people have different numbers of repeats on their chromosomes
26
Positions of other STR regions
TPOX CSF1PO TH01 Each person is unique AMEL 26 26
27
Druid Dracula: DNA testing
With kits just add DNA sample with primers for amelogenin (XY) different STR regions. Amplify and electrophores. Allele ladder shows all varieties in population.
29
CQ9: What is the chance that someone might have 5 and 7 repeats for the STR THO1 just by accident?
STR THO1 allele frequencies 5 6 7 8 9 9.3 10 1/200 1/4 1/6 1/7 1/3 1/100 A: 1/200 B: 1/206 C: 1/600 D: 1/1200 E: 1/2600
30
Hardman’s Arrest Standard police work identified Matthew Hardman as a suspect. Preliminary DNA testing provided enough evidence to arrest Hardman on suspicion of murder. During the arrest, a knife was found in his coat pocket. Subsequent DNA testing revealed two sources of DNA on the knife, one from Hardman and one matching the victim. The possibility of a random match was one in 73 million. A search of Hardman’s dwelling produced magazines and evidence of accessing internet sites featuring how to become a vampire. Matthew Hardman was found guilty of murder on August 2, 2002, and sentenced to life imprisonment.
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.