1. Topics DNA organization, structure, & function Replication RNA Protein Synthesis –Transcription –Translation

2. DNA Function genetic information –how to build, operate, and repair cell –Specifically how and when to make proteins passed from one cell generation to the next; –From one cell to the next within an individual –passed from parent to child

3. DNA Organization DNA molecule = genes + “non-coding DNA) gene =protein instructions non-coding = when to activate gene/make a protein chromosome ~3% of DNA “coding” “chromosome” ~97% of DNA genes Non-coding

4. Double helix Two strands twisted together like a corkscrew

5. DNA Structure long chains of nucleotides Nucleotide = sugar + phosphate + nitrogenous base Sugar = deoxyribose (5C) 4 Different Bases: A, T, G, C Bases = pyrimidines (1 ring) or purines (2 rings)

6. 5’ 3’ DNA Structure Cont.: Double Helix double stranded –sugar-phosphate backbone=covalent –base-base=hydrogen Twisted=helix 5’ 3’ covalent bond hydrogen bond ‘f’-five; ‘f’ phosphate; 5’ end

7. DNA Structure Cont.: Complementary Base Pairing 4 different bases Complementary pairing –C—G –A—T

8. Functional Characteristics of DNA: IMPORTANT!! Information = order of the bases/base sequence –ATTGCGCA means something different then: –ATTGCGGA Complementary base pairing Allows DNA to be copied over and over and the information stays the same.

9. DNA Replication Happens as part of cell cycle In preparation for cell division Duplicates all the DNA: 1 copy  2 copies One copy for each cell Semiconservative In nucleus of cell NOT! NOT! NOT! PART OF PROTEIN SYNTHESIS!!!!!!!

10. Base Paring and Replication ATTCGCGATATTCGCGAT TAAGCGCTATAAGCGCTA ATTCGCGATATTCGCGAT TAAGCGCTATAAGCGCTA TTATA TAAGCGCTATAAGCGCTA ATTCGCGATATTCGCGAT

11. 1 copy of all DNA 2 copy of All DNA Replication of DNA 1 copy of DNA Mitosis divides/separate the two copies of identical chromosomes Cytokinesis divides up the cytoplasm contents Parent/mother cell daughter cells: each one identical copy of all the DNA: genetically identical to the mother cell

13. DNA Replication DNA helicase “unzips” the DNA New nucleotides are added/paired with the existing strands DNA polymerase binds the new nucleotides together creating the P-S backbone Result is two identical DNA molecules (i.e., the base sequence is the same)

15. Protein Synthesis: making proteins from DNA 1.Transcription= DNA  mRNA (in nucleus) 2.Translation = mRNA  Protein (in cytoplasm @ ribosome)

16. mRNA Single stranded chains of nucleotides Sugar = ribose Bases and Pairing –G, C, A, U replaces T –G-C –T-A or A-U Codons = 3-base groups –One codon is a “start” codon –Three codons are “stop codons” –Each codon corresponds to a specific amino acid (except stops) 2-59

18. Transcription 3-36 Template strand Coding strand RNA Polymerase

19. Transcription

20. Transcription: from DNA  mRNA –promoter = how much transcription RNA Polymerase unzips gene and moves down DNA –Complimentary RNA nucleotides bind DNA –RNA nucleotides bind together (via RNA poly) –at end of gene mRNA detaches and RNA poly detaches DNA zips up when transcription is done mRNA is made and leaves nucleus and enters cytoplasm 3-35

21. tRNA Single stranded piece of RNA Carried and delivers amino acids Anticodon binds w/ mRNA codon 3-44

24. Mutations, DNA, and Protiens Mutation = change in DNA base sequence change in protien  change in structure and/or function Change DNA sequence Change mRNA sequence Change codons Change amino acid sequence Change protein Change protein function or make non-functional

25. Mutations, DNA, and Protiens Mutation = change in DNA base sequence Mutation = Δ in DNA sequence  Δ in RNA sequence/codons  Δ in amino acid sequence  Δ in protein –change in protein  change in structure and/or function

26. Restriction Enzymes: Discovered in bacteria Cut DNA at specific locations TTTCCTGATCGTTTCCTGATCG AAAGCACTAGCAAAGCACTAGC TTTTTT AAAGCAAAGC CCTGATCGCCTGATCG ACTAGCACTAGC

27. Genetic Expression: from DNA to cell function/structure DNA  mRNA  Proteins  cell function/structure structure transport contraction receptors cell ID hormones/signaling This is the big picture: The instructions on DNA make proteins when the cell receives a signal and then those proteins are synthesized and used as enzymes, transport proteins, receptors, hormones or as building materials for the cell so that the cell can carry out its functions

28. Protein Synthesis and the Genetic Code 3-43 DNA template strand