1. Tweaking BLAST Although you normally see BLAST as a web page with boxes to place data in and tick boxes, etc., it is actually a command line program that can be run just by typing the appropriate command and options, e.g. >blastall –p blastn –i my_sequence.fasta –d refseq This is the simplest form: where the basic program ‘blastall’ takes a number of different options, or parameters, indicated by the –x and followed by its value. -p -i -d There are many other parameters, and if not listed explicitly they will use a default value most appropriate to the blast flavour requested. E.g. for –W blastn uses –W 11, where blastx uses –W 3. There are also some options that appear on the web pages that are not really parameters but manage the job in a similar way. One of the most useful of these is on the NCBI blast pages where you can use Entrez queries or pick from an organism list to modify your search.

2. The Many Parameters of BLAST There are almost literally hundreds of parameters, but most are way too obscure even for die-hard techies like me! Very few of them are regularly useful in any but their default value, but just occasionally they are very necessary. Here are some of the ones that I have used: -e max expected value -moutput format(graphical or tabular/spreadsheet) -F filter query sequence for low complexity(default TRUE) -U use only upper case regions of query (default FALSE) -Ggap opening cost -E gap extension cost -q nucleotide mismatch penalty (BLASTx uses matrices) -r nucleotide match reward -b number of matching sequences to report -g allow gaps (default TRUE) -W word size -z effective database size (removes effect of actual database size!) -S query strands to search(default both directions) -lrestrict database sequences to given list of ‘gi‘ numbers

4. BLAST Parameters Exercises 1. BLASTn vs. BLASTx Open the file example-sequences.html, copy the sequence: >blastn-vs-blastx This is a Xenopus tropicalis cDNA sequence. Go to the NCBI BLAST Home Page/Nucleotide-nucleotide BLAST (blastn) section. Paste your sequence into the box.Nucleotide-nucleotide BLAST (blastn) Run BLASTn against the nr nucleotide database using all default options. Then hit [format] to wait for the results in a new page. (hint if you paste the sequence definition line ‘>name’ into the box as well, your results will be labelled accordingly, which can be useful) Now repeat but go to the TRANSLATED BLAST section, and BLAST against the nr protein database using BLASTx. How might the different results help us view the presence of this gene in other vertebrates?

5. Results for Exercise 1. BLASTn BLASTx

6. BLAST Parameters Exercises 2. Low complexity filtering Open the file example-sequences.html, copy the sequence: >low-complexity-filtering-A This is sequence contains a long AT tandem repeat. Go to the NCBI BLAST Home Page/TRANSLATED BLAST section/BLASTx. Paste your sequence into the box. Carefully UNTICK the “Choose filter [ ] Low complexity” BOX in the second section. And then run BLASTx against the nr database.Choose filter What do you feel about these alignments? Re-run, but leave the low-complexity filter ON this time. Does this change our view of the protein matches? Now continue with >low-complexity-filtering-B and –C. C is an especially interesting case – what can we deduce about the cDNA sequence? Annotators beware!

7. Results for Exercise 2A (OFF) BLASTn – low complexity filtering OFF

8. Results for Exercise 2A (ON) BLASTn – low complexity filtering ON

9. Results for Exercise 2B ONOFF

10. Results for Exercise 2C There is a sequence error, an extra G at position 117 in the sequence: cDNA (117) AGAAAAGAAGAAACATGGCAATGGATCAGAA |||||||||||||||| |||||||||||||| AGAAAAGAAGAAACAT-GCAATGGATCAGAA Genomic sequence ON OFF

11. BLAST Parameters Exercises 3. Limit by Entrez query Entrez queries can be used in the NCBI BLAST web page to restrict the search to more specific items. For instance to find only matching sequences in fruit fly, enter ‘Drosophila melanogaster[ORGN]’ in the Limit by entrez query box in the second section (you can also select the organism from the adjacent drop-down list).Limit by entrez query To combine items use logical AND, OR or NOT. Open the file example-sequences.html. Copy the sequence >cyclin-D1-Xt and go to the NCBI BLAST Home Page/ TRANSLATED BLAST section/BLASTx, and paste the sequence. Use an Entrez query to find all rodent sequences (rat and mouse) with a good match to cyclin-D1. At what E-value do we expect we are no longer looking at cyclins? Try running the search again with that E-value as a limit…

12. BLAST Parameters Exercises 4. BLASTn vs tBLASTx and nucleotide mismatch penalties Open the file example-sequences.html. Also open the NCBI BLAST Home Page/SPECIAL – Align two sequences section. There are several Xenopus tropicalis cyclins in the examples file. Copy the sequence >cyclin-A1-Xt to the Sequence 1 BLAST window Copy the sequence >cyclin-A2-Xt to the Sequence 2 BLAST window (i) Run the default comparison, should be BLASTn. Note the alignment. Now run again using tBLASTx – what does this do to our understanding of the relationship between these two sequences? Are they homologs, orthologs or paralogs – or none of these? (ii) Revert to BLASTn, and try varying the values for mismatch penalties and gapping – start by reducing the mismatch penalty to -1. Then try reducing the gap open and gap extension penalties…. What do we learn from this? (iii) Now repeat the first parts of the exercise with cyclin-D1 in place of cyclin-A2…

13. Results for Exercise 4 (i) BLASTntBLASTx

14. Results for Exercise 4 (ii) Mismatch penalty = -2 (default)Mismatch penalty = -1

15. BLAST Parameters Exercises 5. Word Size Go to: informatics.gurdon.cam.ac.uk/online/workshops/useful-web-sites.html Open example-sequences.html Copy the sequence >morpholino go to the NCBI BLAST Home Page. Go to the NUCLEOTIDE BLAST section, BLASTn, and paste the sequence. Check OFF the low complexity filter, and then run the search. Now re-run the search, setting the following parameters: Low complexity OFF Expect 100 Word Size7 Other advanced -q-1 (mismatch penalty -1 instead of default -3) What difference does this make?