1. Protein Synthesis DNA Transcription and Translation

2. What is the purpose for proteins? We are made of protein! antibody: fight diseases Muscle contractions Enzymes Hormones Hair, feathers, beaks, nails, horns, etc. Egg whites Transport proteins: blood(hemoglobin)

3. Protein Structure Made up of amino acids Polypeptide- string of amino acids ONLY 20 amino acids are arranged in different orders to make a variety of proteins!!!! Amino acids are in the cytoplasm. Assembled on a ribosome

5. How Does Our Body Create Proteins from DNA?? Its in the nucleus!!!!!!

6. DNA mRNA Transcription Introduction The Central Dogma of Molecular Biology Cell Polypeptide (protein) Translation Ribosome

7. DOGMA? This central dogma(process) was develop by Crick. This was a hypothesis on how the code was read from DNA then used to make proteins. Scientists did not like this term for this hypothesis because it sounds like a problem!

8. Central Dogma of Biology The flow of information in the cell starts at DNA,

9. Location???? Prokaryotic Cyotoplasm and ribosomes Eukaryotic Nucleus and ribosomes

10. DNA vs. RNA(players) DNA Double Helix Deoxyribose sugar Adenine pairs with Thymine (A-T) Stays in nucleus RNA Single strand Ribose sugar Uracil replaces Thymine! Leaves nucleus to do the work

11. DNA vs. RNA DNARNA DeoxyriboseRibsose Thymine Uracil is one of the bases in RNA. There is thymine no thymine. This means A goes with U and G still goes with C. Double StrandSingle Strand

12. Steps to Protein Synthesis 1.Transcription – process where DNA message is changed into mRNA then out of nucleus to the ribosomes!!! 2. Translation – process when mRNA is translated into amino acid chains(protein) on the ribosomes.

13. Transcription??? Purpose? Creating? WHY WHY WHY!!!!!!

14. How does a protein get built?? This is where RNA becomes involved. DNA is too large to get out of the nuclear membrane pores. SO RNA has to be made to go to the ribosomes!!!

16. SO, HOW DOES AN AMINO ACID CHAIN GET BUILT? RNA stands for ribonucleic acid

17. Stars of Translation and Transcription 1.mRNA 2.DNA 3.rRNA 4.tRNA 5.Ribsomes 6.RNA polymerase

18. Three types of RNA: 1. mRNA “messenger” RNA Carries code for proteins from DNA Carries “codon” 2. tRNA “ transfer” RNA Attaches specific Amino Acids to the protein chain by matching the mRNA codon with the anticodon.

19. RNA TRANSCIPTION There are three (3) types RNA: 1. Messanger RNA – (mRNA) carries messages from the DNA in the nucleus to the ribosomes.

20. tRNA 2. Transfer RNA – (tRNA) 20 different kinds which are only able to bond with one (1) specific type of amino acid.

21. rRNA 3. Ribosomal RNA – (rRNA) major component (part) of the ribosomes

22. 3. Ribosomal RNA - rRNA Where Protein synthesis occurs

23. How Does RNA polymerase(complex) know where to start and stop? Promoter site: starting and stopping point on DNA. Specific base sequences that represents a gene. Termination site: Place where RNA polymerase stops!!! REMEMBER - only a gene is being read to make mRNA not all of your DNA.

24. Step 1: RNA polymerase complex attaches to DNA at special places that serve as the start signal(promoter sites). Only one gene!!!!!

25. Step 2: DNA splits at site of RNA polymerase. RNA polymerase attaches matching bases to form new RNA strand from DNA template.

26. RNA polymerase keeps adding bases making the RNA strand grow…

27. Step 3: RNA polymerase leaves DNA when reaches the termination site(stop signal). RNA strand is released and goes to cytoplasm. DNA rewinds itself into the double helix.

28. Results of Transcription Strand of mRNA made from the DNA

29. FYI RNA polymerase doesn’t check for mistakes in the code. Doesn’t cause mutations when there is a few mistakes in proteins unlike replication.

30. Protein Synthesis: Transcription

31. Making mature mRNA Original mRNA transcribed is not mature mRNA Exons: readable segments of mRNA that will be spliced together to make mature mRNA. Introns: are non- readable segments of mRNA that must be removed before it leaves the nucleus

32. Exons vs. Introns Once introns removed, mRNA is ready to leave the nucleus!!!!

33. DNA Cytoplasm Nucleus Eukaryotic Transcription Export G AAAAAA RNA Transcription Nuclear pores G AAAAAA RNA Processing mRNA

34. Prokaryotic Protein Synthesis All occurs in the cyotplasm!!!

35. Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code?

36. Translation Translation is the process of decoding a mRNA molecule into a polypeptide chain or protein. ALWAYS read mRNA!!!!!!

37. Reading Frame Every 3 DNA bases pairs with 3 mRNA bases Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases

38. Codons Each combination of 3 nucleotides on mRNA is called a codon or three- letter code word. Each codon specifies a particular amino acid that is to be placed in the polypeptide chain (protein).

39. Protein Synthesis: Translation

40. Start codons and Stop codons For translation to begin, there is a START codon. AUG: is the 3 letter codon that starts the process. UAA, UGA, UAG: Stop codons.

41. SUGAR-PHOSPHATE BACKBONE B A S E S H P O O HO O O CH 2 NH 2 N NH N N HOH P O O HO O O CH 2 NH 2 N N N N H P O OH HO O O CH 2 NH 2 N N N N O A Codon Guanine Adenine Arginine

42. Protein Synthesis: Translation

43. Start Codon Start codon: codon AUG also serves as the “initiator” codon, which starts the synthesis of a protein.

44. Stop Codon STOP codon: Codon that signal the end of the protein. (UAA, UAG, & UGA Besides selecting the amino acid methionine, the codon AUG also serves as the “initiator” codon, which starts the synthesis of a protein

46. Protein Synthesis: Translation A three-letter code is used because there are 20 different amino acids that are used to make proteins. If a two-letter code were used there would not be enough codons to select all 20 amino acids. That is, there are 4 bases in RNA, so 4 2 (4x 4)=16; where as 4 3 (4x4x4)=64.

47. Translation Therefore, there is a total of 64 codons with mRNA, 61specify a particular amino acid. This means there are more than one codon for each of the 20 amino acids.

48. Protein Synthesis: Translation Transfer RNA (tRNA) Each tRNA molecule has 2 important sites of attachment. One site, called the anticodon, binds to the codon on the mRNA molecule. The other site attaches to a particular amino acid. During protein synthesis, the anticodon of a tRNA molecule base pairs with the appropriate mRNA codon.

49. tRNA Transfer RNA Bound to one amino acid on one end Anticodon on the other end complements mRNA codon

50. Methionine Met-tRNA A C U Anticodon

51. Protein Synthesis: Translation

52. Parts of a Ribosomes For translation to begin, 2 subunits of ribsosomes must unite, separate in cytoplasm –Large –Small Contain 3 binding sites – helps tRNA align to codon. –E –P –A

53. Protein Synthesis: Translation

54. RNA TRANSLATION Protein Synthesis: the formation of a protein using information coded on DNA and carried out by RNA in the assembly of amino acids. Proteins are: a.Amino acids in chains – 20 kinds b.Made of 10’s or 100’s or 1000’s of amino acids c.Must be arranged in a specific sequence for each type of protein d.Function & type of protein is determined by amino acid sequence e.DNA makes RNA f.RNA constructs amino acids

55. Steps of Translation 1. INITIATION: A.The initiator(start) codon AUG binds to the first anticodon of tRNA, signaling the start of a protein. B. Two parts of the ribosome join around the tRNA and mRNA. The amino acid methionine, the codon AUG also serves as the “initiator” codon, which starts the synthesis of a protein

57. Translation 2. ELONGATION: The anticodon of another tRNA binds to the next mRNA codon, bringing the 2nd amino acid to be placed in the protein. This will continue until stop codon. As each anticodon & codon bind together a peptide bond forms between the two amino acids.

58. Protein Synthesis: Translation 3. Termination: The protein chain continues to grow until a stop codon reaches the ribosome, which results in the release of the new protein and mRNA, completing the process of translation. The amino acids are bonded with a peptide bond to form a protein. Release factor causes the release of tRNA and mRNA.

60. Summary of Translation Ribosome 2 parts come together. mRNA attaches to ribosome. AUG – start codon. tRNA brings in making anticodon with amino acid. rRNA continues to read mRNA and bring in making tRNA. *Stop codon will stop process. Peptide bonds will form to make a protein.

62. tRNA Function Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code

63. Protein Synthesis: Translation Transfer RNA (tRNA) Each tRNA molecule has 2 important sites of attachment. One site, called the anticodon, binds to the codon on the mRNA molecule. The other site attaches to a particular amino acid. During protein synthesis, the anticodon of a tRNA molecule base pairs with the appropriate mRNA codon.

64. MethionineMet-tRNA A C U Anticodon

65. A E Large subunit P Small subunit Translation - Initiation fMet UAC GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 5’5’ mRNA 3’3’

66. A E Ribosome P CCA Arg UCU Phe Leu Met Ser Gly Polypeptide Translation - Elongation GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 5’5’ mRNA 3’3’

67. A E Ribosome P Phe Leu Met Ser Gly Polypeptide Arg Aminoacyl tRNA UCUCCA Translation - Elongation GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 5’5’ mRNA 3’3’

68. A E Ribosome P Translation - Elongation Aminoacyl tRNA CGA Ala CCA Arg UCU Phe Leu Met Ser Gly Polypeptide GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 5’5’ mRNA 3’3’

69. A E Ribosome P Translation - Elongation CCA Arg UCU Phe Leu Met Ser Gly Polypeptide CGA Ala GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 5’5’ mRNA 3’3’

70. Protein Synthesis: Translation

71. The Genetic Code

72. ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGGACUG Protein Synthesis: Translation

73. ANYTHING ACID AMINE Protein Synthesis C O OHCN H H H C HOH C H O CN H H H C HH C H O OHCN H H H C HOH Serine C H O OHCN H H H C HH Alanine H C O OHC R N H H Amino Acid H2OH2O

74. 3’3’ 5’5’ 5’5’ 3’3’ Transcription And Translation In Prokaryotes Ribosome 5’5’ mRNA RNA Pol.

75. Transcription vs. Translation Review Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein

76. ANYTHING ACID AMINE Protein Synthesis C O OHCN H H H C HOH C H O CN H H H C HH C H O OHCN H H H C HOH Serine C H O OHCN H H H C HH Alanine H C O OHC R N H H Amino Acid H2OH2O

77. A E Ribosome P CCA Arg UCU Phe Leu Met Ser Gly Polypeptide Translation - Elongation GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 5’5’ mRNA 3’3’

78. Prokaryotic - Protein synthesis Location – cytoplasm At the same time. Eukaryotic – Protein synthesis

79. 3’3’ 5’5’ 5’5’ 3’3’ Transcription And Translation In Prokaryotes Ribosome 5’5’ mRNA RNA Pol.

80. (1961) Watson & Crick proposed… …DNA controlled cell function by serving as a template for PROTEIN structure.…DNA controlled cell function by serving as a template for PROTEIN structure. 3 Nucleotides = a triplet or CODON3 Nucleotides = a triplet or CODON (which code for a specific AMINO ACID) See p.303 AMINO ACIDS are the building blocks of proteins.AMINO ACIDS are the building blocks of proteins.

81. MUTATIONS Changes in DNA that affect genetic information

82. Gene Mutations Point Mutations – changes in one nucleotides 1. Substitution – base is replaced THE FAT CAT ATE THE RAT THE FAT HAT ATE THE RAT

83. Gene Mutations 2. Insertion – a base is added THE FAT CAT ATE THE RAT THE FAT HCA TAT ETH ERA T H Point Mutations that cause Frameshift Mutations – shifts the reading frame of the genetic message so that the protein may not be able to perform its function. 3. Deletion – delete a base THE FAT CAT ATE THE RAT TEF ATC ATA TET GER AT

84. Effects of Mutations Silent – When a base pair is substituted but the change still codes for the same amino acid in sequence. NO CHANGE!!!

85. Effects 0f Mutations Missense –Mutation that causes a changed amino acid. Usually harmful!!! EX: sickle cell amenia

86. Effects of Mutations Nonsense – Mutation that does not allow protein to form because of early stop codon

87. Sex Chromosome Abnormalities XYY Syndrome –Normal male traits –Often tall and thin –Associated with antisocial and behavioral problems

88. Chromosome Mutations Changes in number and structure of entire chromosomes Original Chromosome ABC * DEF DeletionAC * DEF DuplicationABBC * DEF InversionAED * CBF TranslocationABC * JKL GHI * DEF

89. Significance of Mutations Most are neutral Eye color Birth marks Some are harmful Sickle Cell Anemia Down Syndrome Some are beneficial Sickle Cell Anemia to Malaria Immunity to HIV

90. What Causes Mutations? There are two ways in which DNA can become mutated: –Mutations can be inherited. Parent to child –Mutations can be acquired. Environmental damage Mistakes when DNA is copied

91. Chromosome Mutations Down Syndrome –Chromosome 21 does not separate correctly. –They have 47 chromosomes in stead of 46. –Children with Down Syndrome develop slower, may have heart and stomach illnesses and vary greatly in their degree of inteligence.

92. Chromosome Mutations Cri-du-chat –Deletion of material on 5 th chromosome –Characterized by the cat-like cry made by cri-du-chat babies –Varied levels of metal handicaps

93. Sex Chromosome Abnormalities Klinefelter’s Syndrome –XXY, XXYY, XXXY –Male –Sterility –Small testicles –Breast enlargement

94. Sex Chromosome Abnormalities XYY Syndrome –Normal male traits –Often tall and thin –Associated with antisocial and behavioral problems

95. Sex Chromosome Mutations Turner’s Syndrome –X –Female –sex organs don't mature at adolescence – sterility –short stature

96. Sex Chromosome Mutations XXX –Trisomy X –Female –Little or no visible differences –tall stature –learning disabilities –limited fertility