Download presentation
Presentation is loading. Please wait.
Published byJustina Sherman Modified over 8 years ago
1
Jonathan Kindberg BNFO 301 04/24/2013 Is there a correlation between similar cluster phages’ tandem repeats within the tape measure protein and its location within that gene?
2
Tape Measure Protein Tail of a phage is used to inject it’s DNA into the host bacterium, which is the beginning of lysis. Tail of a phage is used to inject it’s DNA into the host bacterium, which is the beginning of lysis. The tape measure protein got its name because the length of the corresponding gene is proportional to the length of the phage's tail: a fact shown by actually copying or splicing out parts of DNA in exemplar species [1]. The tape measure protein got its name because the length of the corresponding gene is proportional to the length of the phage's tail: a fact shown by actually copying or splicing out parts of DNA in exemplar species [1]. Tandem Repeats are the tell tale sign of the tape measure protein Tandem Repeats are the tell tale sign of the tape measure protein
3
Tandem Repeats Tandem repeats occur when more than one nucleotide is repeated Tandem repeats occur when more than one nucleotide is repeated The nucleotide repeats lie adjacent to each other within the gene. The nucleotide repeats lie adjacent to each other within the gene. TR example: ATGTAAGCTAAGCTAAGCTTG TR example: ATGTAAGCTAAGCTAAGCTTG The tandem repeat consists of TAAGC The tandem repeat consists of TAAGC
4
Experimental Procedure Phagesdb.org to look at similar cluster phages Phagesdb.org to look at similar cluster phages Look for tandem repeats in he genomes to find the tmp gene with the use of PhAnToMe/BioBIKE Look for tandem repeats in he genomes to find the tmp gene with the use of PhAnToMe/BioBIKE PhAnToMe/BioBIKE functions will include SEQUENCE-SIMILAR-TO and ALIGNMENT-OF PhAnToMe/BioBIKE functions will include SEQUENCE-SIMILAR-TO and ALIGNMENT-OF Scatter plot of the phages tandem repeats vs. location in their genome will be graphed Scatter plot of the phages tandem repeats vs. location in their genome will be graphed Analysis of experimental findings Analysis of experimental findings
5
Experimental Tools Phagesdb.org Phagesdb.org PhAnToMe/BioBIKE PhAnToMe/BioBIKE Tandem Repeat Finder Tandem Repeat Finder Blast Blast Oracle Virtual Machine Oracle Virtual Machine Allows me to find phamerator maps of annotated phages. Allows me to find phamerator maps of annotated phages.
6
Results TBD TBD
7
References 1. 1. The evolution of the tape measure protein: units, duplications and losses: Belcaid M, Bergeron A, Poisson G. BMC Bioinformatics. 2011 Oct 5;12 Suppl 9:S10. doi: 10.1186/1471-2105- 12-S9-S10.http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3271669/http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3271669/ 2. 2. Length Determination in Bacteriophage Lambda Tails. Katsura, I and Hendrix, R. Cell, Vol. 39, 691-698, December 1984. http://ac.els-cdn.com/0092867484904768/1-s2.0- 0092867484904768-main.pdf?_tid=46972fa4-9c69-11e2-b6bc- 00000aab0f26&acdnat=1364998854_34031474c286eed57d3f1aadfd1a1d92http://ac.els-cdn.com/0092867484904768/1-s2.0- 0092867484904768-main.pdf?_tid=46972fa4-9c69-11e2-b6bc- 00000aab0f26&acdnat=1364998854_34031474c286eed57d3f1aadfd1a1d92 3. 3. Mechanism of Length Determination in Bacteriophage Lambda Tail. Katsura, Isao. Department of Biology, College of Arts and Sciences, The University of Tokyo, Meguro-ku, Tokyo 153, Japan. Adv. Biophys., Vol. 26, pp. 1-18 (1990).
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.