1. 1 Perl Syntax: control structures Learning Perl, Schwartz

2. 2 FYI http://www.nimblegen.com/

3. 3 Outline Control structures –if, for, while, foreach File Handles and Streams Regular Expressions -- a start

4. 4 Expression Evaluation for Control Structures if (CONDITION) { ….. lines in this block will be executed } CONDITIONS evaluate as true: 1)any string except "" and "0" 2)Any number except 0 3)Any reference is true All undefined values are false

5. 5 Control Structures Provides the capability to make decisions based on results if( something is true) do this else do something else

6. 6 if Control Structure if (condition) { execute block } elsif (condition) { } elsif (condition) { } : else { }

7. 7 if Control Structure if ( $i > 60) { print "Length of line is ".length($line)." \n"; } if ($sequence eq 'ATG') { $start_index = $x; $j =$j + 1; } else { print "Start codon not found."; } Note that in C -- you can have a single line of execution following an "if" if(j > 60) printf ("print statement here \n",j);

8. 8 Examples if ($sequence eq 'ATG') { $start_index = $x; $j = $j + 1; } elsif ($sequence eq 'ATT') { $stop_location = $y; } else { print "Start/stop codons not found."; }

9. 9 Block/Braces Conventions if ($i == 5) { # this is how most of the world writes code print "Hello world.\n"; } else { $x=0; } ####################################### if ($i == 5) # this is an alternative sometimes used { # either way is purely a stylistic choice print "Hello world.\n"; } else { $x=0; }

10. 10 Iterative/Looping Control Structures while (condition) { #block is repeatedly ….block# executed as long as }# condition is TRUE while ($count < 300) { $count++; # same as $count = $count + 1; $number = ; &calc_sales($number); }

11. 11 Strange Example #!/usr/bin/perl ## hellow world #comments $i = "ATG"; $j = "TTTG"; if($i == $k) { print "Prof braun was wrong\n"; }

12. 12 for loop for( initialization; condition; execute) { block } 1)Initialization statement is executed, first, only once 2)CONDITION is evaluated, if true BLOCK is executed 3)EXECUTE is performed 4)Go to 2)

13. 13 for loop for( initialization; expression; execute) { block } Equivalent to while loop initialization; while (expression){ block execute }

14. 14 for loop examples (nearly identical to C structure) for ($i=0; $i<4; $i = $i+1) { print "Counting $i \n"; } print "Out of loop: $i \n"; Counting 0 Counting 1 Counting 2 Counting 3 Out of loop: 4

15. 15 for loop examples for (my $i=0; $i<4; $i = $i+1) { print "Counting $i \n"; } print "Out of loop: $i \n"; Counting 0 Counting 1 Counting 2 Counting 3 Out of loop: for( ; $i<10 ; ) { # expressions are optional – none == infinite loop }

16. 16 foreach Really no equivalent in C. foreach SCALAR ( ARRAY) { } @nts = (A,T,C); foreach $nucleotide (@nts) { print $nucleotide."\n"; } A T C

17. 17 Side Notes auto increment/decrement $i++; #same as $i = $i +1 $i--; chomp(STRING) and chop(STRING) chomp removes only 1 newline at end of string or variable (if one exists) chop removes last character of string

18. 18 STDIN, STDOUT, Filehandles STDIN -- input "stream" (ex. keyboard -- are there others?) STDOUT -- output "stream" (ex. screen) Filehandles -- similar to streams -- input from, and output to files

19. 19 More Side Notes chomp ($text = ); $text = ; chomp($text); # defined EXPR ; # returns a boolean value saying whether EXPR has a real value or not -- scalar with non-zero string or numeric $text = "hello"; if (defined($text)) { : } May be used to determine if subroutines or filehandle exists.

20. 20 Filehandles name for a file, device, socket, or pipe filehandle name is arbitrary (one of few examples where $ is NOT used) open(FILE, "filename"); open(UP, "test"); # read from file "test" open(WRITE,">filename"); # write to file "filename" open(NOW, ">>test"); # append to a file close (FH);

21. 21 Filehandles Examples # STDOUT is default output – to screen # STDIN is default input – from keyboard print STDOUT "Enter a number: "; $num = ; print STDOUT "the number is $num\n"; open(BOB, "test"); $line = ; #read one line from "test" open(NEW,">output"); print NEW "$line"; #write $line to file "output"

22. 22 Pipes and File redirection | -- pipe operator (Unix) Example: File ("names") contains: Tim Tracy Bob cat names | sort > look Output: Bob Tim Tracy cat names | sort | wc > look > -- redirection operator ls > look Places files and directories into the file named “look”

23. 23 Regular Expressions (regexp) Regular Expression – template that matches a set of strings –very useful for text processing and pattern matching document and text processing – text editors, etc formatted and unformatted data genomic data (sequences, ESTs, genes, microarray, etc) >gi|25952121|ref|NM_033028.2| Homo sapiens Bardet-Biedl syndrome 4 (BBS4), mRNA GACTTCCGGCCGCGCAGCGGTGGGCTGAGCTAAAATGGCTGAGGAGAGAGTCGCGACGAGAACTCAATTT CCTGTATCTACTGAGTCTCAAAAACCCCGGCAGAAAAAAGCTCCAGAGTTTCCTATTTTGG… default variable: $_ –in many cases, Perl will automatically use $_ as the default variable Examples: $_ = "test\n"; print; # prints $_ by default foreach (1..5) { # no variable specified print "Count $_ \n"; } $_ will show up more in later lectures

24. 24 Pattern Matching To compare a pattern (regular expression): $_ = "ATCGAGAGCATGCCATGCAT"; if(/ATG/) { print "Found sequence\n"; } Remember naïve.pl

25. 25 Regular Expressions metacharacters (.) period – matches any character except newline (\) backslash – makes any metacharacter a non-metacharacter Example: 3.145 would match 3b145 3\.145 would match 3.145

26. 26 Regular Expressions Quantifier metacharacters (*) asterisk – match preceding item 0 or more times /ATGC*ATG/ matches ATGATG, ATGCATG, ATGCCCCCCCCCCCCCCCCCCCCATG, etc. (+) plus – match preceding item 1 or more times (?) question mark – match preceding item 0 or 1 times /ATGC?ATG/ only matches ATGCATG and ATGATG

27. 27 General Quantifiers /a{5,15}/ matches between 5, and 15 "a" matches if first 15, if more than 15 "a" /(fred){3,}/ matches 3 or more "fred" with no upper limit – fredfredfred /(fred){3}/ matches exactly fredfredfred * = {0,}zero or more + = {1,}one or more ? = {0,1}zero or one

28. #!/usr/bin/perl #ping for 1 week #every 5 minutes #12 per hour = 2016 pings $|=1; #output auto flush $num_pings=2016; $count = 0; $date = `date /t`; # Wed 09/17/2008 chomp($date); $date =~ s/(\w+)\s(\d+)\/(\d+)\/(\d+)(\s+)/$2$3$4/; $file = ">>PingLog".$date.".txt"; print "file = $file\n"; while($count<$num_pings) { print "pinging\n"; open(PING,$file); #$results = `ping 12.217.250.200`; $results = `ping 128.255.22.207`; #$results = system("ping 128.255.22.207"); print "results = $results\n"; $date = `date /t`; $time = `time /t`; $_ = $results; if(m/Reply/) { print PING "Success: $date $time $results\n"; } else { print PING "FAIL: $date $time $results\n"; } print PING "---------------------------------------\n"; close(PING); $count++; $ticks = 150; # 2 * 150 = 300 secs = 5 mins while($ticks>0) { print "$count $ticks \r"; sleep(2); $ticks--; } print "\n"; } 28

29. FAIL: Wed 04/30/2008 08:33 PM Pinging 128.255.22.207 with 32 bytes of data: Request timed out. Ping statistics for 128.255.22.207: Packets: Sent = 4, Received = 0, Lost = 4 (100% loss), --------------------------------------- Success: Wed 04/30/2008 08:38 PM Pinging 128.255.22.207 with 32 bytes of data: Reply from 128.255.22.207: bytes=32 time=22ms TTL=51 Reply from 128.255.22.207: bytes=32 time=21ms TTL=51 Reply from 128.255.22.207: bytes=32 time=23ms TTL=51 Reply from 128.255.22.207: bytes=32 time=21ms TTL=51 Ping statistics for 128.255.22.207: Packets: Sent = 4, Received = 4, Lost = 0 (0% loss), Approximate round trip times in milli-seconds: Minimum = 21ms, Maximum = 23ms, Average = 21ms --------------------------------------- 29

30. ping 128.255.22.1 What the output of "ping" should look like: Pinging 128.255.22.1 with 32 bytes of data: Reply from 128.255.22.1: bytes=32 time=24ms TTL=52 Ping statistics for 128.255.22.1: Packets: Sent = 4, Received = 4, Lost = 0 (0% loss), Approximate round trip times in milli-seconds: Minimum = 22ms, Maximum = 25ms, Average = 23ms 30

31. Ping failure Pinging 128.255.22.1 with 32 bytes of data: Request timed out. Ping statistics for 128.255.22.1: Packets: Sent = 4, Received = 0, Lost = 4 (100% loss), 31

32. 32 END