1. 3/30
6.2 exit slip
Protein Synthesis 6.3! HW
finish worksheet
Quiz 6.1

2. Transcription and Translation
GENE TO PROTEIN

3. DNA determines your unique characteristics. A Review…
DNA is the instructions for making proteins.
Proteins play a big role in everything you do and determine most of your characteristics

4. Examples of Proteins Enzymes Connective Muscle Fibers
Carrier Molecules
Hormones
Antibodies
Membrane Channels
Pigments
Cytoskeleton

5. 2 Stages
Transcription
Translation
DNA → mRNA
mRNA → Protein

6. mRNA? What’s that?

7. DNA → mRNA Uracil replaces Thymine
DO NOT say A turns into U. A codes for U
The DNA does not become or mutate into the RNA
DNA nucleotide codes for
RNA nucleotide
Adenine (A)
Uracil (U)
Thymine (T)
Guanine (G)
Cytosine (C)

8. Transcription
The enzyme RNA polymerase builds an RNA strand complementary to the DNA

9. The following diagram shows the strands of DNA unwinding and RNA nucleotides being added…

10. This diagram just shows how the RNA strand breaks off from the DNA template…

11. Where Does Transcription Begin?
At the promoter (for our simulations the TATAA box)
Proteins called transcription factors help RNA Polymerase bind to the DNA

12. Prokaryotes vs. Eukaryotes
No nucleus
Transcription and translation happen relatively simultaneously
Transcription in nucleus
mRNA edited before translation (beyond our scope)
mRNA leaves nucleus for translation

13. Translation
The mRNA serves as instructions for assembling a protein

14. How?
The sequence of mRNA nucleotides determines the order of amino acids in the protein
Every 3 nucleotides (codon) codes for one amino acid

15. So the process basically works like this….

16. Remember Amino Acids?

17. Order of Amino Acids Determine Protein Structure
Due to
Side Chains

18. Translation Details
Occurs in the ribosome in both prokaryotes and eukaryotes
mRNA brings the code from transcription
tRNA carries in amino acids one by one
Protein is assembled

19. How Does the tRNA “know” Which Amino Acid to Bring?
The anticodon on the tRNA is complementary to the codon on the mRNA
Hydrogen bonds

20. More Realistic View

21. The Start and Stop Codons
Start Codon
Stop Codon
Begins translation
Always AUG
So Met is always the first amino acid
DOES NOT code for an amino acid
Stops translation

22. You can determine which amino acid is coded for by each codon by looking at the following table:
*Note: there is one codon (AUG) that is the start codon – this is present at the beginning of each gene that codes for a different protein. Also, there are 3 stop
codons that do not code for any amino acid but signal the end of a gene.

23. 1. mRNA attaches to a RIBOSOME at start codon

24. The process continues until a stop codon is reached.
The protein is then released from the ribosome.

25. To make the process of translation faster and to make many copies of a protein, multiple ribosomes can move along mRNA at once looking something like this…

26. Figure: 14-11b
Title: Mass Production
Caption: (b) A micrograph of this process in operation. The figure shows two mRNA strands with ribosomes spaced along their length. In the upper strand, translation is under way and polypeptides can be seen emerging from the ribosomes.

27. Review DNA: AGCGCTATAAGCTACGCGCAGCATT mRNA: CGAUGGCGUCGUAA
tRNA: UACCGCAGC
Protein Met-Arg-Ser
Review
Promoter
Stop Codon
Start Codon

28. Figure: 14-11b
Title: Mass Production
Caption: (b) A micrograph of this process in operation. The figure shows two mRNA strands with ribosomes spaced along their length. In the upper strand, translation is under way and polypeptides can be seen emerging from the ribosomes.

29. Rapid Review Transcription makes mRNA based on the DNA
Occurs in nucleus
Begins at promoter
Translation assembles protein based on mRNA code
With help of tRNA in ribosome
Begins at start codon. Ends at stop codon
The structure and shape of the protein depends on the DNA sequence

30. Keep in mind… Genes don’t code for traits
They code for proteins (or parts of proteins) that can affect traits
i.e. they can code for a protein that makes eyes brown
Differences in DNA determine differences in proteins = differences in physical traits.

31. Transcription Animation

32. Basic Translation Animation
nslation_vo1.html

33. Detailed Translation Animation