2. Structure and Replication of DNA

3. John Kyrk Animations http://www.johnkyrk.com/DNAanatomy.html

4. Are Genes Composed of DNA or Protein? DNA – Only four nucleotides thought to have monotonous structure Protein – 20 different amino acids – greater potential variation – More protein in chromosomes than DNA

5. Bacterial Transformation Experiments Fredrick Griffith (1928) –demonstrate the existence of “Transforming Principle,” a substance able to transfer a heritable phenotype (trait) from one strain of bacteria to another. Avery MacLeod and McCarty – determine the transforming principle was DNA.

6. Streptococcus Pneumoniae

7. Griffith Experiment

8. Avery Experiment

9. Viruses Injecting DNA into a Bacterium Bacterial cell Phage head Tail sheath Tail fiber DNA 100 nm

10. Hershey Chase Experiment – Viruses can be used to transfer traits and therefore DNA

11. Traits can be transferred if DNA is transferred. (a) Tobacco plant expressing a firefly gene (b) Pig expressing a jellyfish gene

12. Additional Evidence Chargaff Ratios % A = %T and %G = %C ( Complexity in DNA Structure) ATGC Arabidopsis29%29%20%20% Humans31%31%18%18% Staphlococcus13%13%37%37% DNA Content of Diploid and Haploid cells – Haploid cells contain half of the amount of DNA GametesSomatic Cells Humans 3.25pg 7.30 pg Chicken 1.267pg 2.49pg

13. DNA Friedrich Meischer (1869) extracted a phosphorous rich material from nuclei of which he named nuclein DNA – deoxyribonucleic acid - Monomer – Nucleotide Deoxyribose Phosphate Nitrogenous Base (4 types – 2 purines G & A; 2 pyrimidines T & C) - Phosphodiester Bond linkage - DNA has direction - 5’ and 3’ ends - Chromosomes are composed of DNA

14. Fig. 16-UN1 Purines have two rings. Pyrimidines have one ring. Purine + purine: too wide Pyrimidine + pyrimidine: too narrow Purine + pyrimidine: width consistent with X-ray data

15. Watson and Crick Model Franklins X-Ray Data – DNA is Double Helix 2 nm diameter Phosphates on outside 3.4 nm periodicity Bases 0.34nm apart Watson and Crick – Base Pairing- Purine with Pyrimidine (A/T & C/G)

17. DNA double helix (2 nm in diameter) Nucleosome (10 nm in diameter) Histones Histone tail H1 DNA, the double helixHistones Nucleosomes, or “beads on a string” (10-nm fiber) DNA Structure – Chromatin = unwound DNA video

18. Chromatin coils around proteins to form Chromosomes 30-nm fiber Chromatid (700 nm) LoopsScaffold 300-nm fiber Replicated chromosome (1,400 nm) 30-nm fiber Looped domains (300-nm fiber) Metaphase chromosome

19. 30 nm chromatin fiber 1.Held together by histone tails interacting with neighboring nucleosomes 2.Inhibits transcription 3.Allows DNA replication

20. DNA Replication: Semiconservative Replication- DNA unzips and a new strand builds on the inside. The new strands each have a piece of the “old” DNA

21. Other Models of Replication Conservative Replication Semi-Conservative Replication Dispersive Replication

22. Culture Bacteria in 15 N isotope (DNA fully 15 N) One Cell Division in 14 N 2 nd Cell Division in 14 N Less Dense More Dense Density Centrifugation 15 N DNA 15 N/ 14 N DNA 14 N DNA

24. DNA Replication: A Closer Look The copying of DNA is remarkable in its speed and accuracy More than a dozen enzymes and other proteins participate in DNA replication Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

25. Replication bubbles are the “unzipped” sections where replication occurs all along the molecule At the end of each replication bubble is a replication fork: a Y-shaped region where new DNA strands are elongating Helicase: enzyme that unzips the double helix at the replication forks Single-strand binding protein binds to and stabilizes single-stranded DNA until it can be used as a template Topoisomerase corrects “overwinding” ahead of replication forks by breaking, swiveling, and rejoining DNA strands Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

26. Origins of Replication Video

27. Fig. 16-13 Topoisomerase Helicase Primase Single-strand binding proteins RNA primer 5 5 53 3 3

29. DNA Polymerase – enzyme that builds the new strand 3’ 5’ 3’ 5’ Pol

30. Leading and Lagging Strands – Polymerase only works on the 3’ to 5’ DNA side. Must do the 5’ to 3’ side in segments called Okazaki fragments. 3’ to 5’ = Leading (easy) strand; 5’ to 3’ = lagging (segmented) strand 5’ 3’ Leading Strand Lagging Strand Pol 3’ 5’ Okazaki Fragments RNA Primer Video

31. Other Proteins at Replication Fork Pol 5’ 3’ Leading Strand Lagging Strand Pol 3’ 5’ Okazaki Fragments Helicase Single Stranded Binding Proteins Primase DNA Pol I Ligase DNA Pol III

32. Lagging strand assembly and Okazaki fragments Overview Origin of replication Leading strand Lagging strand Overall directions of replication Template strand RNA primer Okazaki fragment Overall direction of replication 1 2 3 2 1 1 1 1 2 2 5 1 3 3 3 3 3 3 3 3 3 5 5 5 5 5 5 5 5 5 5 5 3 3

33. Damaged DNA Nuclease Excision Repair – cut and replace Nuclease DNA Polymerase Ligase

34. Replicating the Ends of DNA Molecules Limitations of DNA polymerase create problems for the linear DNA of eukaryotic chromosomes The usual replication machinery provides no way to complete the 5 ends, so repeated rounds of replication produce shorter DNA molecules Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

35. Replicating Ends of Linear Chromosomes

36. Fig. 16-19 Ends of parental DNA strands Leading strand Lagging strand Last fragment Previous fragment Parental strand RNA primer Removal of primers and replacement with DNA where a 3 end is available Second round of replication New leading strand New lagging strand Further rounds of replication Shorter and shorter daughter molecules 5 3 3 3 3 3 5 5 5 5

37. If chromosomes of germ (sex) cells became shorter in every cell cycle, essential genes would eventually be missing from the gametes they produce An enzyme called telomerase catalyzes the lengthening of telomeres in germ cells; it adds temporary DNA so the strand can be completed Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

38. Telomerase

39. Telomeres 1 µm

40. END STRUCTURE/REPLICATION Crash Course Video DNA Activities

41. Chapter 10 From Gene to Protein

42. Protein Synthesis: overview One gene-one enzyme hypothesis (Beadle and Tatum) One gene-one polypeptide (protein) hypothesis Transcription: synthesis of RNA under the direction of DNA (mRNA) Translation: actual synthesis of a polypeptide under the direction of mRNA

43. The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait DNA gets all the glory, but proteins do all the work!

44. mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa protein translation ribosome trait

45. Genetic Code

46. Identifying Polypeptide Sequence Locate start codon ( 1st AUG from 5’ end) Identify Codons (non overlapping units of three codons including and following start codon) Stop at stop codon (remember stop codon doesn’t encode amino acid) Nucleotides before start codon – 5’UTR – untranslated region Nucleotides after stop codon - 3’UTR [MetArgAsnAlaSerLeu] GACGACGGAUGCGCAAUGCGUCUCUAUGAGACGUAGCUCAC 5’

47. The Genetic Code Use the code by reading from the center to the outside Example: AUG codes for Methionine

48. Name the Amino Acids GGG? UCA? CAU? GCA? AAA?

49. Central Dogma of Molecular Biology

51. Transcription from DNA nucleic acid language to RNA nucleic acid language

52. RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… RNADNA transcription

53. Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase template strand rewinding mRNA RNA polymerase unwinding coding strand DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU 5 3 5 3 3 5 build RNA 5  3

54. Animation of Transcription http://vcell.ndsu.nodak.edu/animations/trans cription/movie-flash.htm http://vcell.ndsu.nodak.edu/animations/trans cription/movie-flash.htm

55. RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 Makes tRNA each has a specific promoter sequence it recognizes

56. Which gene is read? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors (helpers) Enhancer region binding site far upstream of gene turns transcription on HIGH Gives RNA Polymerase a chance to “warm up”

57. Transcription Factors Initiation complex transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA

59. Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3'

60. Transcription: the process 1.Initiation~ transcription factors mediate the binding of RNA polymerase to an initiation sequence (TATA box) 2.Elongation~ RNA polymerase continues unwinding DNA and adding nucleotides to the 3’ end (makes the mRNA strand) 3.Termination~ RNA polymerase reaches terminator sequence

62. Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

63. mRNA splicing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Post-transcriptional processing eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript ~10,000 bases ~1,000 bases

64. RNA Processing in Eukaryotes 5’ 3’ Modification of 5’ and 3’ ends Pre-mRNA (hnRNA) Spicing of exons 5’CAP Poly A tail Exon1 Intron1 Exon2 Intron2 Exon3 Intron3 Exon4

65. 1977 | 1993 Richard Roberts Philip Sharp CSHL MIT adenovirus common cold Discovery of exons/introns beta-thalassemia

66. Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame (mutation) AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

67. RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5' No, not smurfs! “snurps” snRNPs small nuclear RNA proteins Spliceosome several snRNPs recognize splice site sequence cut & paste gene

69. Alternative splicing Alternative mRNAs produced from same gene Introns for one gene may be exons for another different segments treated as exons Starting to get hard to define a gene!

70. More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the mRNA add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer: produces more protein

71. Translation from mRNA language to amino acid language

72. Players in Translation mRNA – Code Ribosome – synthesizes protein tRNA – adaptor molecule, brings AA to ribosomes Amino acids Aminoacyl tRNA synthetases - attach amino acids to tRNAs

73. tRNA

74. Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

75. Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily activating enzyme anticodon tRNA Trp binds to UGG codon of mRNA Trp mRNA ACC UGG C=O OH H2OH2O O tRNA Trp tryptophan attached to tRNA Trp C=O O

77. Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small EP A

78. Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site

79. Ribosomes

80. How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 4 20 ATCG AUCG

81. AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? codon

82. Cracking the code 1960 | 1968 Crick determined 3-letter (triplet) codon system Nirenberg & Khorana WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17)  determined mRNA–amino acid match  added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine

83. 1960 | 1968 Marshall Nirenberg Har Khorana

84. The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Start codon  AUG  methionine Stop codons  UGA, UAA, UAG Why is the wobble good?

85. How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon 53 3 5 35 UAC Met GCA Arg CAU Val

86. Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Translocation – Ribosome ratchets over on codon. The tRNA that was in the A site is moved to the P site. The uncharged tRNA in the P site exits the ribosome through the E site. Termination end codon When ribosome reaches the stop codon a release factor binds to the A site and triggers the release of the polypeptide. The ribosome releases the tRNA and the mRNA. 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'

87. Fig. 17-18-4 Amino end of polypeptide mRNA 5 3 E P site A site GTP GDP E P A E PA GTP Ribosome ready for next aminoacyl tRNA E P A

89. The Functional and Evolutionary Importance of Introns Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing Such variations are called alternative RNA splicing Because of alternative splicing, the number of different proteins an organism can produce is much greater than its number of genes Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

90. Fig. 17-12 Gene DNA Exon 1Exon 2 Exon 3 Intron Transcription RNA processing Translation Domain 2 Domain 3 Domain 1 Polypeptide

91. Polysomes – teamed ribosomes translating together

92. Polypeptide synthesis always begins in the cytosol (cytoplasm) Synthesis finishes in the cytosol unless the polypeptide signals the ribosome to attach to the ER Polypeptides destined for the ER or for secretion are marked by a signal peptide A signal-recognition particle (SRP) binds to the signal peptide The SRP brings the signal peptide and its ribosome to the ER Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

93. Proteins targeted to ER

94. Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' GTP cap poly-A tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

95. END Protein Synthesis

96. Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

97. Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed Translation in Prokaryotes

98. Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing

99. When do mutations affect the next generation? Mutations Point mutations single base change base-pair substitution silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon

100. Point mutation leads to Sickle cell anemia What kind of mutation? Missense!

101. Sickle cell anemia Primarily in African races/descendants recessive inheritance pattern strikes 1 out of 400 African Americans hydrophilic amino acid hydrophobic amino acid

102. Mutations Frameshift shift in the reading frame changes everything “downstream” insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?

103. Cystic fibrosis Primarily European races/descendants strikes 1 in 2500 births 1 in 25 whites is a carrier (Aa) normal allele codes for a membrane protein that transports Cl - across cell membrane defective or absent channels limit transport of Cl - (& H 2 O) across cell membrane thicker & stickier mucus coats around cells mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections without treatment children die before 5; with treatment can live past their late 20s

104. Deletion leads to Cystic fibrosis loss of one amino acid delta F508

105. 2007-2008 What’s the value of mutations?