Presentation is loading. Please wait.

Presentation is loading. Please wait.

Howard Hughes Medical Institute-NMSU Research Scholar

Similar presentations


Presentation on theme: "Howard Hughes Medical Institute-NMSU Research Scholar"— Presentation transcript:

1 Howard Hughes Medical Institute-NMSU Research Scholar
Microsatellite Identification in the Thick-billed Parrot (Rhynchopsitta pachyrhyncha) By: Daniel Acosta Howard Hughes Medical Institute-NMSU Research Scholar Dr. Wright’s Lab Department of Biology

2 Thick-billed Parrot International Union for Conservation of Nature (IUCN 2007) World Parrot Trust Historic range: Southwestern United States and Northern Mexico (Snyder et. al., 1999) Habitat degradation and fragmentation from logging

3 Range

4 Genetic Variation High degree of genetic variation to reduce the impact of founder effect, which may lead to genetic differentiation To adapt to a changing environment and to avoid reduced reproductive fitness. Importance to any translocation.

5 Microsatellites Microsatellites are simple sequence repeats (1-6) base pairs long: e.g. GTGTGTGTGTGT or ACGACGACGACGACGACGACG found in the genome of both prokaryotic and eukaryotic organisms Found in coding and non-coding regions They have a high mutation rate and high variability in natural populations. High degree of polymorphism All of these characteristics makes microsatellites a class of genetic marker that is highly useful to assess genetic variation.

6 Methods: Isolation of Microsatellites
Boil clone in TE buffer Genetic Library DNA Extraction PCR T3/T7 T3/T7/GT10 (Kongrit et. al., 2008) (Zane et. al. 2002)

7 Methods: Primer Design
Sequencing Primer Design CCGAGTAGGACAGAGCCTTGGGTGGCATGGTTTAGTGGGAGGTGTCCCTGCCCACGGCATGGGGTTTGGAACTAGATGATCTTAAGGTCCTTTACAGCCCTAACTGTTCTATGATTCTATTGGGTCTCAAGGGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCATTTTCCTCTTCAGGGTGGA ATAAGAGCCTTGAATTACAACATTAAACCTTTTAAATGG Test for amplification in thick-billed parrot DNA Optimize Primers Polymorphism

8 Polymorphism Having genetic diversity
Proportion of loci polymorphic: Number of polymorphic loci / total number of loci sampled We can also calculate allelic diversity: If we have sampled 6 loci and the diversity is as follows (1, 3, 3, 2, 2, 3) Allelic diversity=( ) / 6 = 2 These calculations tell us a great deal about the genetic variation of the target population

9 Progress and Future Goals
Up to date: 3 primers we designed and 4 designed for other species. These primers have been optimized for [Mg] and annealing temperature. We now propose to use these primers to assess the genetic variation not only of the wild population, but of the captive population. Compare wild population to captive population

10 Acknowledgements Howard Hughes Medical Institute-NMSU Research Program
Dr. Timothy Wright Ph. D Student Erin Schirtzinger Ph. D Student Swati Mukherjee Ph. D Student Alejandro Salinas Nadine San Diego Zoo Kari L. American Museum of Natural History

11 References IUCN Rhynchopsitta pachyrhyncha. < (March 26, ). Kongrit, C. et. at. (2008). Isolation and characterization of dinucleotide microsatellite loci in the Asian elephant (Elephas maximus). Molecular Ecology 8, Snyder, N. F. R., E. C. Enkerlin-Hoeflich, and M. A. Cruz-Neto Thick-billed Parrot (Rhynchopsitta pachyrhyncha) The Birds of North America 24 Zane, L., Bargelloni, L., & Patarnello, T. (2002). Strategies for microsatellite isolation: a review. Molecular Ecology 11, 1-16g

12 Picture Sources (map)

13 Questions??


Download ppt "Howard Hughes Medical Institute-NMSU Research Scholar"

Similar presentations


Ads by Google