1. Spring 2002Christophe Roos - Bioinfo primer Informatics goes system biology Christophe Roos - MediCel ltd christophe.roos@medicel.fi Gene-networks in signaling Drosophila as a model Molecular biology goes in silico

2. Spring 2002Christophe Roos - Bioinfo primer From single cell to organism – a life cycle The use of a model organism Fertilisation followed by cell division Pattern formation – instructions for –Body plan (Axes: A-P, D-V) –Germ layers (ecto-, meso-, endoderm) Cell movement - form – gastrulation Cell differentiation Cell growth, cell death (apoptosis)

3. Spring 2002Christophe Roos - Bioinfo primer Development of the body plan We are much more like flies in our development than you might think. Drosophila is the best understood of all developmental systems. We have evolved by two genome duplications Like all animals with bilateral symmetry, the fly embryo is patterned along two distinct and largely independent axes: Anterior-Posterior and Dorsal-Ventral

4. Spring 2002Christophe Roos - Bioinfo primer Pattern formation – germ layers

5. Spring 2002Christophe Roos - Bioinfo primer From lab bench to computer keyboard Molecular biology is the mother of Biotechnology, an area with huge potential applications. Molecular biology has handled on single genes and proteins, but now methods make it possible to operate on large sets simultaneously. Information technology is an essential enabling technolgy(tool) in molecular biology. We know it as bioinformatics or biocomputing. Bioinformatics is to a large extent a predictive science, the results of which enter public and private electronic databases. 5 text slides Bioinfo

6. Spring 2002Christophe Roos - Bioinfo primer The experimental data hits the hard disk Biological data is accumulating at a high rate –DNA and protein sequence –Gene expression profiles –Protein structure –Scientific litterature are accumulating at a high rate. The genome of several organisms has been sequenced (many viruses and bacteria, yeast, C.elegans and the fruitfly Drosophila). Most of the DNA sequence of the complete human genome has been determined. 4 text slides Bioinfo

7. Spring 2002Christophe Roos - Bioinfo primer … but what is the data? genome, gene, protein Each cell contains a full genome (some exceptions), it consists of DNA The size varies: –Small for viruses and prokaryotes (10 kbp-20Mbp) –Medium for lower eukaryotes Yeast, unicellular eukaryote 13 Mbp Worm (Caenorhabditis elegans) 100 Mbp Fly, invertebrate (Drosophila melanogaster) 170 Mbp –Larger for higher eukaryotes Mouse and man 3.000 Mbp –Very variable for plants (many are polyploid) Mouse ear cress (Arabidopsis thaliana) 120 Mbp Lilies 60.000 Mbp 3 text slides Bioinfo

8. Spring 2002Christophe Roos - Bioinfo primer … the data The genome is partitioned over one or many chromosomes. Their number is constant within a species but varies between species (range ca. 1-100). The chromosome is one DNA double helix molecule A gene is the smallest functional unit on a chromosome that codes for a protein or an effector RNA (e.g. tRNA and rRNA). The gene is directional (5’ end → 3’ end). –Regulatory regions (promotor & enhancer) –Transcribed regions: exons and introns Introns are spliced away during maturation, exons are concatenated Exons make up the 5’ UTR, the CDS and the 3’ UTR) genome, gene, protein chromosome mRNA 5’UTRCDS3’UTR promotor 2 text slides Bioinfo

9. Spring 2002Christophe Roos - Bioinfo primer The proteins are formed by amino acids, each of them (20 different) is coded for by one or several triplets (4 3 =64 different). As the gene code is read is triplets, it is essential to keep the frame correct (theoretically 3 forward and 3 reverse frames for any DNA segment). The polypeptide chain is linear but folds into a 3D-structure. –The 3D structure is pivotal for the function of most proteins –The 3D structure consists of folds –Some discrete structures make up the folds (  -helix,  -sheet, etc.) –The 3D structure cannot (yet) be predicted, but can be measured by NMR or X-ray spectroscopy of crystals. –The structure is not static and depends also on partners. … the data genome, gene, protein Last insert Bioinfo

10. Spring 2002Christophe Roos - Bioinfo primer Genes control cell behavior by controlling which proteins are made by a cell Genomic content constant: all cells have the same instructive set Differential gene activity controls development Understanding development means a.o. understanding gene control Chromatin structure Transcription Processing (splicing) Nuclear export Cytoplasmic location (storage) Translation Modifications of the polypeptide Glycosylation (sugars) Proteolytic cleavage Complex formation

11. Spring 2002Christophe Roos - Bioinfo primer Development is progressive Specification of cell fate: determination –All cells still ‘look the same’ –Can be tested by transplantation experiments Interactions can make cells different from each other: induction

12. Spring 2002Christophe Roos - Bioinfo primer Patterning – interpretation of positional information Positional value –Morphogen – a substance –Threshold concentration Program for development –Generative rather than descriptive

13. Spring 2002Christophe Roos - Bioinfo primer The bicoid gene provides an A-P morphogen gradient

14. Spring 2002Christophe Roos - Bioinfo primer The A-P axis is divided into broad regions by gap gene expression The first zygotic genes Respond to maternally-derived instructions Short-lived proteins, gives bell- shaped distribution from source

15. Spring 2002Christophe Roos - Bioinfo primer Transcription factors in cascade Hunchback (hb), a gap gene, responds to the dose of bicoid protein A concentration above threshold of bicoid activates the expression of hb The more bicoid transcripts, the further back hb expression goes

16. Spring 2002Christophe Roos - Bioinfo primer Krüppel reads two values Krüppel (Kr), a gap gene, responds to the dose of hb protein A concentration above minimum threshold of hb activates the expression of Kr A concentration above maximum threshold of hb inactivates the expression of Kr

17. Spring 2002Christophe Roos - Bioinfo primer Segmentation: activation of the pair- rule genes Parasegments are delimited by expression of pair-rule genes in a periodic pattern Each is expressed in a series of 7 transverse stripes

18. Spring 2002Christophe Roos - Bioinfo primer Universals: The homeotic genes also specify human development Lewis Wolpert, Rosa Beddington, Jeremy Brockes, Thomas Jessel, Peter Lawrence, Elliot Meyerowitz, Principles of Development, Current Biology ltd, Oxford University Press 1998, ISBN 0-19-850263-X

19. Spring 2002Christophe Roos - Bioinfo primer Genes are controlled by activating and repressing transcription factors that bind the promotor The 500bp promoter region of the even-skipped gene Gene expression occurs when the activating factors are present above a threshold Repressors may act by preventing binding of activators promotor

20. Spring 2002Christophe Roos - Bioinfo primer … understand the promotor What we might know about the promotor:...CAGTGCTAATATAAAACTGATATTTAATTGAAATCTTTTCTAATTTAGCGCGCTCAGCTGTTGGGTGACCTTGCTGCCGTTCAAATTCCGGAGGAGGAGCTGCAGCAGTATACTTCC ATTAGCCAAGTGCAAACCGTGGGATTAAAGCGTCTACCCACCCTTGACGAGTATCTAGCCAAGAAAAAGGAAAGACAGGCCCAAGTTTTAGCTGAAAAAAGCTCGGCGTCGGGTCTCCGC GTAAATGCTATAAAGGGCTCCAAGCGCAAGCTTCTCGTCGAAGAGGAGGAGGAACTACAGGCCAAGCGAAAGAATCCGAATGTAATTAGCGTGGAGGAAGATGACGAAGATTCTTCATCC TCTGATGAGGACGATGAGGAGGCACCAGCTCAATCCGCTCCTATTGCCATACCCACTCCAGTGTCTATAGCTCCACCGCAAATCGCTGTTAAACCACCCATTAAAAAGTTGAAGCCAGAG CCTAACCCACCTGCCTGTATCCACCAGACTGTCTATGTGCCCGTACATCGGACAACAGAAGTTCAGAATGCCCGTCTTCGACTGCCTATCCTCGCGGAGGAGCAGCAGGTGATGGAGACA ATCAACGAAAACCCCATTGTGATCGTGGCTGGTGAGACTGGCTCTGGAAAGACTACCCAGCTACCGCAGTTCCTGTACGAAGCGGGGTATGCCCAGCACAAGATGATTGGAGTGACGGAG CCGCGGCGAGTGGCTGCTATTGCCATGTCCAAGCGGGTGGCCCACGAGATGAACCTGCCGGAGAGCGAGGTGTCATACCTCATTCGCTTCGAGGGAAACGTAACACCAGCGACGCGCATT AAATTCATGACAGATGGTGTGTTGCTTAAGGAGATCGAAACTGACTTTCTGCTTAGTAAGTACTCAGTGATCATCCTGGACGAGGCGCACGAGCGCAGTGTTTACACAGACATCCTAGTG GGTCTCCTGTCAAGGATCGTGCCCTTGCGTCACAAACGCGGGCAGCCGCTGAAGCTGATCATTATGTCTGCCACTTTGCGGGTATCCGATTTTACAGAGAATACTCGCTTGTTTAAGATT CCGCCACCGTTGCTTAAAGTGGAGGCTCGACAATTTCCGGTGACTATTCACTTCCAGAAGCGCACACCTGATGACTATGTGGCGGAGGCTTACCGCAAGACCTTAAAAATCCATAATAAG CTTCCGGAAGGCGGCATACTAATTTTTGTGACGGGACAGCAGGAGGTCAACCAACTGGTGCGCAAGCTGCGACGTACGTTTCCGTATCATCATGCGCCAACCAAGGATGTCGCTAAAAAT GGAAAGGTATCGGAGGAAGAAAAAGAGGAAACAATAGATGATGCGGCATCGACTGTGGAGGATCCCAAGGAGCTGGAGTTTGATATGAAACGAGTTATACGTAATATTCGTAAATCTAAG AAAAAGTTCTTGGCGCAAATGGCGTTACCCAAAATCAATTTGGACGACTACAAGCTCCCTGGTGATGATACGGAAGCAGACATGCACGAGCAGCCGGATGAGGATGATGAGCAGGAGGGA CTAGAAGAGGATAACGACGATGAACTAGGCTTGGAGGATGAGTCGGGAATGGGATCTGGTCAAAGGCAACCTCTGTGGGTCCTGCCGCTCTACTCGCTCCTCTCCTCGGAGAAGCAAAAC CGCATCTTCCTGCCCGTTCCCGATGGCTGCCGGCTATGCGTGGTTAGCACCAATGTGGCAGAGACATCTCTCACCATCCCGCACATCAAGTATGTTGTTGACTGTGGTCGCCAGAAGACG CGTCTTTACGACAAACTGACGGGTGTGAGTGCTTTTGTGGTAACCTACACGTCTAAGGCCTCGGCGGATCAGCGTGCTGGACGAGCGGGTCGCATCAGCGCCGGACATTGCTATCGCCTC TACTCGAGTGCCGTGTACAACGACTGCTTCGAGGACTTTTCCCAGCCGGATATCCAGAAAAAGCCCGTCGAGGACCTTATGCTGCAAATGCGCTGCATGGGCATCGATCGCGTGGTGCAC TTTCCCTTTCCCTCACCACCGGATCAAGTGCAGCTGCAAGCCGCCGAGCGGCGATTGATCGTGCTAGGTGCCCTGGAGGTCGCCAAGACAGAGAATACAGATTTGCCACCAGCCGTTACT CGTTTGGGTCACGTTATCTCCCGCTTTCCCGTGGCGCCGCGCTTTGGAAAAATGCTGGCTCTGTCCCACCAGCAGAACCTACTGCCCTACACCGTCTGCCTGGTGGCCGCACTTTCAGTC CAGGAGGTGCTAATCGAAACGGGCGTTCAAAGGGATGAGGATGTGGCACCTGGCGCGAATCGGTTCCACCGCAAACGCCAAAGTTGGGCGGCCAGCGGCAACTATCAGTTGCTTGGAGAT CCTATGGTCTTATTACGTGCCGTAGGAGCTGCAGAGTACGCCGGATCGCAGGGCCGCTTGCCAGAGTTTTGTGCTGCGAATGGATTGCGCCAGAAAGCGATGAGCGAGGTGCGAAAATTG CGCGTCCAGCTGACTAACGAGATTAACCTGAATGTTAGTGACGTTGAGCTGGGTGTGGACCCCGAACTGAAGCCTCCCACCGATGCCCAGGCGCGTTTCCTTCGCCAAATTCTATTGGCC GGCATGGGCGACCGGGTGGCTAGAAAGGTACCTCTGGCAGACATCGCCGACAAGGAAGAGCGGCGGCGATTAAAGTACGCATACAATTGTGCTGACATGGAGGAACCAGCGTTCCTGCAC GTCTCATCCGTGTTGCGTCAAAAAGCACCCGAATGGGTAATCTATCAGGAGGCATACGAGCTGCAAAACGGCGACTCTACCAAGATGTTCATCCGCGGC... This page shows 3000 characters Thus, the human genome has about 10 6 pages … however

21. Spring 2002Christophe Roos - Bioinfo primer … the reality is certainly different What the protein regulators might know about the promotor:

22. Spring 2002Christophe Roos - Bioinfo primer McAdams and Shapiro Science, 1995, 269, pp.650-656 Lytic cycle decision -phage: 11 genes Human Genome: ~ 31 000 – 40 000 genes … and when regulation concerns many genes simultaneously… There is more than promotors

23. Spring 2002Christophe Roos - Bioinfo primer Data types will diversify While the promotor is a challenge to bioinformatics, it is only one tiny facet of biological data Other data types concern among other –Gene transcripts or proteins present At various time points In different tissues In diseases –Interactions between components –Pathways Metabolic Regulatory How can it be organised?

24. Spring 2002Christophe Roos - Bioinfo primer Pathway database, interaction database,...

25. Spring 2002Christophe Roos - Bioinfo primer A wealth of databases Primary and derived databases Each one accessible via separate tools sometimes cross- indexed with separate syntax with different levels of confidence with errors We have a problem

26. Spring 2002Christophe Roos - Bioinfo primer Biology in the computing age What does informatics mean to biologists? Representing the data to the user Organising the data in databases Disseminating the data over Internet Manipulating and interlinking of the data Analysing of the data What challenges does biology offer computer scientists? Cracking the genome code Presenting data in an intelligible form Biological data is complex and interlinked Multiple entities interact to form pathways, networks Model, simulate and understand how living things function

27. Spring 2002Christophe Roos - Bioinfo primer System biology needs more Mathematics, systematics, semantics Reverse engineering Modelling Data mining However, it has to be done starting from biological premises