1. Fundamentals of Forensic DNA Typing
Chapter 2
Basics of DNA Biology and Genetics
Fundamentals of Forensic DNA Typing
Slides prepared by John M. Butler
June 2009

2. Chapter 2 – DNA Biology Review
Chapter Summary
Deoxyribonucleic acid (DNA), which is composed of a four letter alphabet (A,T,C, and G), provides the blueprint of life and is found in each nucleated cell of our body. Within the nucleus of each cell (except red blood cells which have no nucleus), humans have 23 pairs of chromosomes with each member of each chromosome pair being inherited from either one’s father or one’s mother. Specific regions of DNA can be examined to generate a DNA profile. Population studies of various groups are performed in order to measure observed genetic variation with the DNA markers tested. The most widely used DNA marker today in forensic and human identity testing applications is the short tandem repeat (STR).

3. Methods for Human Identification
DNA since 1986
Fingerprints have been used since 1901

4. Some Basic Principles of DNA
DNA = Deoxyribo-Nucleic Acid
It is in almost every cell of our bodies
Found in a long strand, like a piece of rope
Made up of a simple alphabet containing four letters: A, T, C, G
The order of these letters is what makes everyone different
Over 99% of human DNA is the same from person-to-person

5. Individual nucleotides
DNA in the Cell
The vast majority of DNA is the same from person to person
chromosome
cell nucleus
Double stranded DNA molecule
Individual nucleotides
22 pairs + XX or XY
~3 billion total base pairs
Only a Small Varying Region is Targeted and Probed for Each DNA Marker Examined

6. Organization of Information
Volumes in a
Set of Encyclopedias
Printed
23 Pairs of
Chromosomes in a Cell
Genetic

7. Information Storage
You know that no two people share the same fingerprint, but did you know that the cells that make up your body also have a unique fingerprint unlike anyone else’s? Your cells contain a complex molecule that we call DNA. Unless you have an identical twin, no one else has DNA just like yours.
Scientists can analyze DNA. If a criminal leaves DNA at a crime scene, police can use it to prove who committed the crime. At NIST, we help crime labs analyze DNA accurately. We make DNA standards so crime labs can tell if their results are right.
Text Storage is by the order of letters, words and paragraphs
DNA Storage is by the order of nucleotides, genes and chromosomes

8. Identification of Information
Printed Information
Genetic Information
D13S317
Library
Body
Book
Cell
Chapter
Nucleus
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Table 2.1
Page Number
Chromosome
Line on Page
Locus (part of chromosome)
Word
Short DNA sequence
Letter
DNA nucleotides

9. Located in mitochondria
The Human Genome
X Y
Sex-chromosomes
Autosomes
3.2 billion bp
Nuclear DNA - Located in cell nucleus
2 copies per cell
mtDNA
16,569 bp
Located in mitochondria
(multiple copies
in cell cytoplasm)
100s of copies per cell
Only single copy of each autosome shown
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.3
Figure 2.3 The human genome contained in every cell consists of 23 pairs of chromosomes and a small circular genome known as mitochondrial DNA. Chromosomes 1–22 are numbered according to their relative size and occur in single copy pairs within a cell’s nucleus with one copy being inherited from one’s mother and the other copy coming from one’s father. Sex-chromosomes are either X,Y for males or X,X for females. Mitochondrial DNA is inherited only from one’s mother and is located in the mitochondria with hundreds of copies per cell. Together the nuclear DNA material amounts to over three billion base pairs (bp) while mitochondrial DNA is only about 16,569 bp in length.

10. Cell Nucleus – 3 billion bp
Autosomes – 22 pairs – 2 copies per cell
Sex Chromosomes (XX or XY)
mitochondria – in cell cytoplasm
100s of mtDNA copies per cell 10

11. Human Genome and Inheritance1 2 3 4 5 6 7 8 9 11 10 12 13 14 15 16 17 18 19 20 21 22
Sex chromosome
Maternal Contribution
(haploid)
Egg X
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.7
mtDNA 1 2 3 4 5 6 7 8 9 11 10 12 13 14 15 16 17 18 19 20 21 22
Sex chromosome
Paternal Contribution
Sperm
(haploid) X Y or
Mitochondrial DNA 1 2 3 4 5 6 7 8 9 11 10 12 13 14 15 16 17 18 19 20 21 22
Nuclear DNA
Sex chromosomes
Autosomes
Zygote
(diploid)
Figure 2.7 Human genome and inheritance. The haploid complement of chromosomes from a female’s egg combines with the haploid chromosomal complement of a male’s sperm to create a fully diploid zygote, which eventually develops into a child whose non-gamete cells each contain the same genome. Half of the 22 autosomes come from each parent while mtDNA is only inherited from the mother. The father’s contribution of either an X or a Y chromosome determines the child’s sex. X Y
mtDNA
Male Child’s Full Genome

12. The Human DNA Genome within a Cell
The Nucleus = control center for the cell
(one per cell)
Mitochondria = the power houses for the cell
(hundreds per cell)
Mitochondrial DNA
(16,569 bp)
Nuclear DNA
(3.2 billion bp)
Inherited from only your mother
Inherited from both
your mother and your father

13. The Human Genome Project
The Human Genome Project
Molecular biology’s equivalent to NASA’s Apollo space program began in 1990 and concluded in 2003 following a multi-billion dollar effort to decipher the DNA sequence contained inside a human cell
Originally lead by James Watson and from 1992 to completion by Francis Collins
For more information: and
John M. Butler (2009) Fundamentals of Forensic DNA Typing, D.N.A. Box 2.1

14. Characteristics of DNA
Each person has a unique DNA profile (except identical twins).
Each person's DNA is the same in every cell.
An individual’s DNA profile remains the same throughout life.
Half of your DNA comes from your mother and half from your father.
Each person has a unique DNA pattern
Except identifcal twins
Each person’s DNA is the same in every cell.
Semen, blood, hair roots, teeth, bone, organs, muscle
An individual’s DNA profile remains the same throughout life.
Most DNA ist he same from person to person.
Insulin gene, Hemoglobin gene
Some DNA varies from person to person.

15. Genetic Inheritance Father’s Sperm Mother’s Egg Child’s Cell
Nuclear DNA
Child’s Cell
Mitochondrial DNA
Our cells contain a genetic code known as deoxyribonucleic acid, or DNA. It provides a blueprint for life, determining to a great extent our physical attributes and appearance. We inherit half of our genetic code from our mother and half from our father. The diversity we see among people results from unique combinations of nucleotides, the building blocks of DNA that exist in every living organism. Because of the many different ways these nucleotides can combine, all humans, with the exception of identical twins, differ from each other on a genetic level.
Current scientific thinking:
~99.9% of 6 billion letters (2 x 3 billion bp) are the same between people
This 0.1% is still ~6 million differences
Father contributes: 22 autosomes (1 of each pair), X or Y
Mother contributes: 22 autosomes (1 of each pair), X and mtDNA

16. Our DNA Comes from our Parents
Father’s Sperm
Mother’s Egg
Child’s Cell

17. Inheritance Pattern of DNA Profiles
DAD
CHILD
MOM

18. Basis of DNA Profiling
The genome of each individual is unique (with the exception of identical twins) and is inherited from parents
Probe subsets of genetic variation in order to differentiate between individuals (statistical probabilities of a random match are used)
DNA typing must be performed efficiently and reproducibly (information must hold up in court)
Current standard DNA tests DO NOT look at genes – little/no information about race, predisposal to disease, or phenotypical information (eye color, height, hair color) is obtained

19. DNA Marker Nomenclature
TH01
Tyrosine Hydoxylase gene, intron 01
D16S539
D: DNA
16: chromosome 16
S: single copy sequence
539: 539th locus described on chromosome 16

20. Basic Components of Nucleic Acids
5’end |
Phosphate
Sugar—Base…
3’end A) B) 5’ 3’
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.1
Figure 2.1 Basic components of nucleic acids: (A) phosphate sugar backbone with bases coming off the sugar molecules, (B) chemical structure of phosphates and sugar molecules illustrating numbering scheme on the sugar carbon atoms. DNA sequences are conventionally written from 5’-to-3’.

21. Hybridization and Double-Helix Structure
G  C
T = A
C  G T C A G 5’ 3’
denatured
strands
hybridized
Hydrogen bonds
Phosphate-sugar backbone
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.2
Figure 2.2 Base pairing of DNA strands to form double-helix structure.

22. Basic Chromosome Structure and Nomenclaturep
(short arm)
centromere
telomere q
(long arm)
Band 5
Band 3
Chromosome 12
12p3
12q5
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.4
Figure 2.4 Basic chromosome structure and nomenclature. The centromere is a distinctive feature of chromosomes and plays an important role during mitosis. On either side of the centromere are “arms” that extend to terminal regions, known as telomeres. The short arm of a chromosome is designated as “p” while the long arm is referred to as “q”. The band nomenclature refers to physical staining with a Giemsa dye (G-banded). Band localization is determined by G-banding the image of a metaphase spread during cell division. Bands are numbered outward from the centromere with the largest values near the telomeres.

23. Two Primary Forms of DNA Variation
(A) Sequence polymorphism
AGACTAGACATT
AGATTAGGCATT
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.5
(B) Length polymorphism
(AATG)(AATG)(AATG)
Figure 2.5 Two forms of variation in DNA: (A) sequence polymorphisms and (B) length polymorphisms. The short tandem repeat DNA markers discussed in this book are length polymorphisms.
3 repeats
(AATG)(AATG)
2 repeats

24. Comparison of RFLP and PCR-based DNA Typing Methods
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Table 2.2

25. Short Tandem Repeat (STR) Markers
An accordion-like DNA sequence that occurs between genes
TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACAGGTGGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATATCATTGAAAGACAAAACAGAGATGGATGATAGATACATGCTTACAGATGCACAC
= 11 GATA repeats (“11” is all that is reported)
The number of consecutive repeat units can vary between people
Target region
(short tandem repeat)
7 repeats
8 repeats
9 repeats
10 repeats
11 repeats
12 repeats
13 repeats
The FBI has selected 13 core STR loci that must be run in all DNA tests in order to provide a common currency with DNA profiles

26. Position of Forensic STR Markers on Human Chromosomes
13 CODIS Core STR Loci
TPOX
D3S1358
1997
TH01
D8S1179
D5S818
VWA
FGA
Core STR Loci for the United States
D7S820
CSF1PO
AMEL
Sex-typing
D13S317
D16S539
D18S51
D21S11

27. Short Tandem Repeat (STR) Typing
Fluorescent
dye-labeled
primer
Short Tandem Repeat (STR) Typing
STR Repeat Region 3′ 5′ 1 2 3 4 5 6
(Maternal) 3′ 5′
(Paternal) 1 2 3 4 5 6 7 8
GATA
forward primer
hybridization region
reverse primer
hybridization region
75….80….100….120….140….160….180….200….220….240.…260…..
(size in bp)
RFUs
1000
500 6
139bp 8
147bp
DNA Separation and Detection

28. A DNA Profile is Produced by Separating DNA Molecules by Size and Dye Color
LASER Excitation (488 nm)
The labeled fragments are separated (based on size) and detected on a gel or capillary electrophoresis instrument
~2 hours or less
Fragment size ranges from base pairs
Peaks represent labeled DNA fragments separated by electrophoresis
This ‘profile of peaks’ is unique for an individual – a DNA type

29. Two STRs on Different Pairs of Homologous Chromosomes6 3 4 5
Homologous pair of chromosomes
Locus A
Locus B
Allele 1
Allele 2
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.6
Figure 2.6 Schematic representation of two different STR loci on different pairs of homologous chromosomes. The chromosomes with the open circle chromosomes are paternally inherited while the solid centromere chromosomes are maternally inherited. Thus, this individual received the four repeat allele at locus A and the three repeat allele at locus B from their father, and the five repeat allele at locus A and the six repeat allele at locus B from their mother.

30. Genetics and Populations
Genetics involves the study of patterns of inheritance of specific traits between parents and offspring. Rather than study inheritance patterns in single families, much of genetics today involves examining populations.
Populations are groups of individuals and are often classified by grouping together those sharing a common ancestry.

31. Paternity Testing Example
DNA Size
Paternity Testing Example
smaller
larger
Mother 8 12
Obligate allele required by the true father
Child 8 14
“INCLUDED”
Has a “14”
Alleged Father 1 12 14
“EXCLUDED”
Does not have a “14”
Alleged Father 2 11 12

32. Alleged Father(s) is asked to donate DNA sample
PATERNITY TESTING
PCR product size (bp) 11
Father’s Profile? 14
Father
11,14 ?
Alleged Father(s) is asked to donate DNA sample 12 14
Child #1 8 14
Child #2 11 12
Child #3 8 12
Mother
STR Alleles from D13S317

33. A DNA Profile Actually Examines Many Positions to Strengthen Confidence in the Results
8,14
Position #1
Position #2
Position #3
14,18
20,25
8,12
14,17
17,25
Mother
Child
12,14
18,18
20,21
Alleged Father 1
INCLUDED at all positions examined
Can be EXCLUDED as he does not match at any of the positions examined
11,12
15,16
18,23
Alleged Father 2

34.
Gregor Mendel’s Pea Experiments: discovering basic rules for genetic inheritance
Between 1856 and 1863, Gregor Mendel, an Austrian monk, meticulously cultivated and tracked approximately 29,000 pea plants (Pisum sativum).
He studied the following seven characteristics in his pea plants:
(1) color and smoothness of the seeds (grey and round or white and wrinkled),
(2) color of the cotyledons (yellow or green),
(3) color of the flowers (white or violet),
(4) shape of the pods (full or constricted),
(5) color of unripe pods (yellow or green),
(6) position of flowers and pods on the stems (axial or terminal), and
(7) height of the plants (short or tall).
Mendel’s work went unnoticed for many years and was rediscovered in 1900
John M. Butler (2009) Fundamentals of Forensic DNA Typing, D.N.A. Box 2.2
See

35. Laws of Mendelian Genetics
The Law of Segregation states that the two members of a gene pair segregate (separate) from each other during sex-cell formation (meiosis), so that one-half of the sex cells carry one member of the pair and the other one half of the sex cells carry the other member of the gene pair. In other words, chromosome pairs separate during meiosis so that the sex cells (gametes) become haploid and possess only a single copy of a chromosome.
The Law of Independent Assortment states that different segregating gene pairs behave independently due to recombination where genetic material is shuffled between generations.

36. Hardy–Weinberg Equilibrium (HWE)
p2 + 2pq + q2 = 1
Godfrey Hardy
Wilhelm Weinberg
Godfrey Hardy (1877–1947) and Wilhelm Weinberg (1862–1937) both independently discovered the mathematics for independent assortment that is now associated with their names as the Hardy–Weinberg principle.
HWE proportions of genotype frequencies can be reached in a single generation of random mating. HWE is simply a way to relate allele frequencies to genotype frequencies.

37. Father gametes (sperm)
Resulting genotype combinations and frequencies
Punnett Square
Mother gametes (egg) AA Aa p2
2pq aa q2 A a p q AA aA A p2 qp p
Father gametes (sperm) a Aa aa
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.8 q pq q2
Punnett square
Figure 2.8 A cross-multiplication (Punnett) square showing Hardy-Weinberg frequencies resulting from combining two alleles A and a with frequencies p and q, respectively. Note that p + q = 1 and that the Hardy-Weinberg genotype proportions are simply a binomial expansion of (p+q)2, or p2 + 2pq + q2.
Freq (A) = p
Freq (a) = q
p + q = 1
(p + q)2 = p2 + 2pq + q2

38. Relationship between Allele Frequency and Genotype FrequencyAA aa Aa
1.0
Frequency of a allele (q)
Frequency of A allele (p)
0.8
0.6
0.4
0.2
0.0
Frequency of genotype in population p2
2pq q2
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.9
Figure 2.9 Graph depicting genotype frequencies for AA, Aa, and aa when Hardy-Weinberg equilibrium conditions are met. The highest amount of heterozygotes Aa are observed when alleles frequencies for both A and a are 0.5. Adapted from Hartl and Clark (1997).

39. A Three-Generation Family Pedigree with Genetic Results from a Single STR Marker (FGA)1 2 3 4 5 6 7 8 9 10 11
20,22
23.2, 25
20,25
22,25 14 15 16
22,24
22,
23.2 12 13
22,22 17
John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2.10
(b)
22,25
22,23.2
20,25
20,23.2 20 22
23.2 25
Father’s alleles
Mother’s alleles #3 #5 #4 #1 #2
22,25
20,22
20,25
20,20 20 22 25
Father’s alleles
Mother’s alleles
#13
#14
#12 #7 #4
(c)
Figure 2.10 (a) A three generation family pedigree with results from a single genetic locus (STR marker FGA). Squares represent males and circles females. (b) A Punnett square showing the possible allele combinations for offspring of individuals #1 and #2 in the pedigree. Individual #3 is 22,23.2 and inherited the 22 allele from his father and the 23.2 allele from his mother. (c) A Punnett square for one of the families in the second generation showing possible allele combinations for offspring of individuals #4 and #7.

40. Chapter 2 – Points for Discussion
How can denaturation and hybridization of complementary DNA strands be controlled?
What impact has the Human Genome Project had on medicine and health? On forensic DNA testing?
Why is it important to understand the variation at specific genetic markers across many individuals in a population?
Why are some DNA markers named (e.g., TH01, VWA, etc.) while others are named with D-S- designations (e.g., D3S1358)?