1. DNA REPLICATION (semi-conservative method) MOLECULAR BIOLOGY – DNA replication, transcription

2. Figure 5-2 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription REPLICATION FORK 1000 nt / sec ! Meselson-Stahl experiment The enzyme DNA polymerase uses the two parental strands as a template to faithfully synthesise new daughter strands according to the specific Watson & Crick base-pairing system (A-T and G-C)

3. Figure 5-14 Molecular Biology of the Cell (© Garland Science 2008) Unwinding and strand separation achieved by DNA helicase using the enegy released from ATP hydrolysis MOLECULAR BIOLOGY – DNA replication, transcription Semi-conservative replication by DNA polymerase requires that the two anti-parallel parental DNA strands are unwound to give a single stranded templates

4. Figure 5-16 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Secondary structure in the single stranded template can hinder DNApol Single-strand binding proteins facilitate DNApol’s progress

5. Figure 5-3 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Incoming deoxyribonucleotide trisphosphates or dNTPs (i.e. dATP, dCTP, dTTP or dGTP depending on base pairing with TEMPLATE STRAND) Newly synthesised strand replicated in a 5’ - 3’ direction New dNTPs are added to the free 3’OH group of preceding nucleotides in the DNA strand by means of a condensation reaction thus forming a new phosphodiester bond Pyrophosphate and water are by- products

6. UDPdeoxyUDPdTTP ADPdeoxyADPdATP GDPdeoxyGDPdGTP CDPdeoxyCDPdCTP dTDP ribonucleotide reductase kinase Methotrexate anti-cancer drug MOLECULAR BIOLOGY – DNA replication, transcription Folate cofactor only obtainable as a dietary supplement (extra supplements for children and pregnant women) Synthesis of dNTP substrates required for DNA replication

7. Figure 5-18c Molecular Biology of the Cell (© Garland Science 2008) DNApol III MOLECULAR BIOLOGY – DNA replication, transcription Chromosomal DNA synthesis catalysed by DNA polymerase III (DNApol III) DNApol III requires the help of ‘sliding clamp’ in order to bind DNA and start replication The sliding clamp however requires a complex of proteins (i.e. the ‘clamp loading complex’) plus the energy released from ATP hydrolysis to be loaded onto the DNA DNA synthesis can now occur in 5’ - 3’ direction although any base- pairing mistakes can be corrected by removing the incorrect base via the ‘3’-exonuclease activity’ of the DNApol III complex

8. replication direction 3’3’ 3’3’ 5’5’ 5’5’ 3’3’ leading strand 3’3’ 5’5’ 5’5’ 5’5’ 3’3’ lagging strand DNA polymerase synthesizes in 5’  3’ direction therefore the two newly synthesized daughter strands are made differently MOLECULAR BIOLOGY – DNA replication, transcription Okazaki fragments are eventually joined (ligated) together to form a complete strand

9. Figure 5-11 Molecular Biology of the Cell (© Garland Science 2008) DNA polymerase III can not simply start synthesizing a new strand It can only elongate from existing one (i.e. a free 3’OH group is required) MOLECULAR BIOLOGY – DNA replication, transcription How does DNA synthesis get started? A specialized RNA polymerase called ‘DNA primase’ can simply start the synthesis of a new strand using the template DNA strand as a guide These 11-12 nucleotide RNA primers then provide the free 3’OH required by DNApol III to replicate the rest of the DNA

10. MOLECULAR BIOLOGY – DNA replication, transcription DNApol I What happens to the RNA primers and Okazaki fragments on the lagging strand? The ‘gap’ between the Okazaki DNA fragment and the RNA primer is recognised by ‘DNA polymerase I’ that then removes the RNA primer and fills in the space with template directed DNA Lastly the two adjacent DNA Okazaki fragments are joined by the enzyme ‘DNA ligase’ DNApol III completes the synthesis of the DNA Okazaki fragment up until the previous RNA primer without joining the two molecules together Figure 5-12 Molecular Biology of the Cell (© Garland Science 2008)

11. Figure 5-19a Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription DNA Replication Summary N.B. the lagging strand template is bent round so both DNApol’s proceed in the same direction!

12. Figure 5-19b,c Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Detailed electronmicrograph of a bacterial DNA replication fork

13. Figure 5-6 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Electronmicrograph of two replication forks progressing around a circular bacterial DNA genome

14. Figure 5-25 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Summary of bidirectional replication forks with leading and lagging strand synthesis

15. Figure 5-21 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription The action of helicase at the replication fork places great strain on the DNA double helix ahead of it because the two ends of the helix cannot freely rotate with respect to each other

16. Figure 5-22 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription An enzyme called ‘DNA topisomerase I’ relieves this strain by catalysing a break in the phosphodiester backbone of one DNA strand allowing the two ends of the helix to rotate relative to each other

17. MOLECULAR BIOLOGY – DNA replication, transcription http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter11/animation_quiz_2.html DNA replication summary

18. Figure 5-26 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Relatively small bacterial genomes are circular and are usually replicated from a single ‘replication origin’ that consists of tandem repeat rich DNA sequences N.B. bi-directional replication from a single replication origin. Known as OriC in E-coli.

19. Figure 5-34 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Large eukaryotic genomes (multiple linear chromosomes) are replicated from many different ‘origins of replication’ Multiple origins of replication comprising many different sequence variations (approx 100 000 in human genome) Not all activated at the same time Mechanism involves the assembly of the ‘pre-replication complex (pre-RC)’ of proteins prior to their activation and initiation of DNA synthesis

20. During DNA replication there is aProblem with the end of the lagging strand:... progressive shortening of chromosomal ends and genetic instability MOLECULAR BIOLOGY – DNA replication, transcription

21. TTAGGGTTAGGGTTAGGGTTAGGG (TTAGGG) 20-HUNDREDS Telomeres made of many repeats SpeciesRepeat Sequence ArabidopsisTTTAGGG HumanTTAGGG OxytrichaTTTTGGGG Slime MoldTAGGG TetrahymenaTTGGGG TrypanosomeTAGGG Yeast(TG) 1-3 TG 2-3 MOLECULAR BIOLOGY – DNA replication, transcription Chromosome ends comprised of TELOMERES Telomeres provide a kind of ‘buffer’ for the chromosomal ends that protect genes located in the ‘sub telomeric’ regions Therefore only telomeric sequence is lost during DNA replication HOW ARE TELOMERES MAINTAINED?

22. Figure 5-41 Molecular Biology of the Cell (© Garland Science 2008) TELOMERES ARE ELONGATED BY ACTION OF TELOMERASE MOLECULAR BIOLOGY – DNA replication, transcription Conventional DNA synthesis is achieved by RNA priming of the elongated parental strand thus maintaining telomere length and chromosome integrity

23. ~ 150 genes control telomere length in yeast and shortening telomeres is associated with cell senescence and death telomerase highly active in >90% of tumors i.e. cell immortalization and uncontrolled proliferation (drug target) many adult cell types have detectable telomerase activity, but it is a highly regulated, fine tuned activity MOLECULAR BIOLOGY – DNA replication, transcription

24. Correlation between levels of perceived stress and telomere length and action of telomerase MOLECULAR BIOLOGY – DNA replication, transcription RELAX AND KEEP YOUR TELOMERES LONG!

25. MOLECULAR BIOLOGY – DNA replication, transcription Telomere and Telomerase video/ tutorial http://www.youtube.com/watch?v=AJNoTmWsE0s

26. AUG UAA double stranded DNA TRANSLATION protein coding sequence or open reading frame Functional Protein MAPSSRGG….. MOLECULAR BIOLOGY – DNA structure, genetic code TRANSCRIPTION ATG GCT CCT TCT TCC AGA GGT GGC...... TAA TAC CGA GGA AGA AGG TCT CCA CCG...... ATT 5’5’ 5’5’ 3’3’ 3’3’ single stranded mRNA AUG GCU CCU UCU UCC AGA GGU GGC...... UAA TRANSCRIPTION Focus on how the genetic information contained within DNA is copied into RNA and it’s consequences

27. Figure 6-21 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Eukaryotic mRNAs are not synthesised in a form that can be immediately translated to protein i.e. there are processing and translocation steps RNA processing translocation

28. Figure 6-22a Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Polycistronic mRNA (e.g related gene operons) Monocistronic mRNA

29. Table 6-1 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription

30. TRANSCRIPTION INITIATION MOLECULAR BIOLOGY – DNA replication, transcription How does the RNA polymerase recognise the the correct place within DNA to start transcribing mRNA for a gene? Doubel stranded DNA RNA polymerse complex Single stranded mRNA

31. Figure 6-11 (part 1 of 7) Molecular Biology of the Cell (© Garland Science 2008) TRANSCRIPTION START IN PROKARYOTES MOLECULAR BIOLOGY – DNA replication, transcription Molecular interaction with the ‘sigma (  ) factor’ permits RNA polymerase (designated ‘holoenzyme’) to bind DNA at specific regions called ‘promoters’ The core ‘RNA polymerase complex’ (consisting of  &  ’catalytic and 2x  regulatory subunits) alone is unable to recognise and bind DNA

32. Figure 6-12a Molecular Biology of the Cell (© Garland Science 2008) GENE PROMOTER MOLECULAR BIOLOGY – DNA replication, transcription +1 1st ribonucleotide to be incorporated into mRNA The sigma factor recognises ‘consensus’ sequences in the promoter DNA There are x2 consensus sequences at the -35 and -10 positions of the DNA -35-10 Variations in the -35 & -10 DNA sequences of different gene promoters affect how often mRNA synthesis can be initiated. Additionally bacteria have multiple sigma factors each with subtle differences in binding affinity for -35 & -10 sequence variants. The sigma factor recognises -35 & -10 and positions the RNA polymerase in the correct position to start synthesis of mRNA starting from the +1 position -35 -10 +1

33. MOLECULAR BIOLOGY – DNA replication, transcription After initiation, sigma factor disassociates and synthesis of the new mRNA molecule occurs in a 5’ - 3’ direction i.e. ‘elongation phase’ The mRNA sequence is specified by base-pair complementarities with the ‘template/ non-coding/ antisense’ DNA strand and therefore is a copy/ ‘transcript’ of the ‘non-template/ coding/ sense’ strand wit U replacing T 5’5’ 3’3’ 5’5’

34. The repeats are copied into the transcribed mRNA and form a ‘hairpin loop’ that is sensed by the RNA polymerase causing it to pause/ stutter. Weak hydrogen bonding between the run of A nucleotides in the DNA template strand and the U ribonucleotides of the mRNA cause the disassociation of the whole RNA polymerase complex i.e. ‘intrinsic termination’ In other cases the binding of special helicases called ‘Rho (  )proteins’ facilitate the disassociation i.e. ‘rho- dependent termination’ Just as promoter sequences in DNA instruct where transcription should begin, other DNA sequences called ‘terminators’ specify where it should stop. MOLECULAR BIOLOGY – DNA replication, transcription How does RNA polymerase know when to stop? ‘terminators’ sequences are inverted DNA repeats followed by a run of A nucleotides

35. MOLECULAR BIOLOGY – DNA replication, transcription Prokaryotic transcription cycle video/ tutorial http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter12/animation_quiz_1.html

36. Table 6-2 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription TRANSCRIPTION IN EUKARYOTES Additionally transcription occurs in the nucleus and not in the cytoplasm

37. i.e. PROTEIN CODING GENE TRANSCRIPTION Table 6-3 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Recognition of the promoter and the initiation of transcription in eukaryotes is more complex In addition to RNA polymerase a host of other proteins known as the ‘General Transcription Factors (GTFs)’ are required GTF’s help RNA polymerase recognise a T/A rich DNA sequence motif in the promoter called the ‘TATA box’, correctly position it on the ‘chromatin template’ with respect to the +1 position and convert it to form capable of RNA synthesis i.e. help form a ‘pre-initiation complex’

38. MOLECULAR BIOLOGY – DNA replication, transcription Binding of ‘specific transcription factors’ positively or negatively affect frequency of transcription initiation specific transcription factors bind particular DNA sequences only found in the locality of certain genes therefore can help regulate which genes mRNAs are synthesised within a cell (e.g. confine the production of antibodies in white blood cells but not in neurones!) e.g. ‘short-range upstream regulator elements’ e.g. ‘long range enhancer sequences’ Pre-initiation complex of RNA polymerase II and GTFs at TATA box Specific transcription factor binding

39. Figure 6-19 Molecular Biology of the Cell (© Garland Science 2008) CORE PROMOTER MOLECULAR BIOLOGY – DNA replication, transcription

40. Initiation of eukaryotic transcription video/ tutorial http://bcs.whfreeman.com/thelifewire/content/chp14/1402002.html

41. RNA PROCESSING in Eukaryotes MOLECULAR BIOLOGY – DNA replication, transcription Eukaryotic genes typically consist of segments of protein coding DNA sequence called ‘exons’ that are interspersed with non-protein coding sequences called ‘introns’ (that are often very long). Unlike prokaryotes, the DNA sequence encoding eukaryotic protein is not often organised in one continuous length that when transcribed is a fully functional mRNA that can be translated into protein. The mRNA first needs to be ‘processed’ both the exons and introns are transcribed by RNA polymerase II to yield long RNA molecules called ‘Pre-mRNAs’ Pre-mRNA Pre-mRNAs are modified (co- transcriptionally) by addition of a 5’-cap and 3’ polyadenylation motifs (important for stability and translation). CAP AAA (n) the sequence corresponding to the introns is removed from the pre-mRNA in a process called ‘SPLICING’ to yield a ‘mature mRNA’ SPLICING Mature mRNA CAP AAA (n) the ‘spliced’ together protein coding mRNA sequence corresponding to the exons in the DNA can now be translated into function protein (except for ‘untranslated regions/ UTRs’ at the 5’ & 3’ ends

42. Figure 6-22b Molecular Biology of the Cell (© Garland Science 2008) Capping Eukaryotic Pre-mRNA MOLECULAR BIOLOGY – DNA replication, transcription RNA terminal phosphatse ‘Enzyme capping complex (CEC)’ Bound to RNApolII complex and caps the pre-mRNA co- transcriptionally Leads to the covalent attachment of a ‘7-methylguanosine cap (m 7 G cap)’ at the 5’ end of the pre- mRNA via an unusual 5’ - 5’ triphosphate bond The m7G cap ensures: the (pre)mRNA is protected from degradation mRNA export from nucleus mRNA is translated to give functional protein

43. Figure 6-38 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Polyadenylation of Eukaryotic Pre-mRNA Cleavage and polyadenylation specificity factor (CPSF) & cleavage stimulation factor (CstF) CPSF & CstF recognise the cleavage and polyadeylation signals once they have been transcribed into the pre-mRNA CPSF & CstF binding recuits other factors that cleave the pre-mRNA chain free of the RNA polymerase II complex Additionally polymerase (PAP) and poly-A-binding proteins (PABPs) are also recruited to this polyadenylation complex Polyadenylation importance: participates in transcriptional termination protects mRNA from degradation mRNA export from nucleus mRNA translation to give functional protein PAP extends the 3’ end of the RNA by untemplated addition of up to 200 adenosine (A) nucleotides that are then bound by PABPs

44. MOLECULAR BIOLOGY – DNA replication, transcription mRNA capping and polyadenylation video/ tutorial http://www.youtube.com/watch?v=YjWuVrzvZYA

45. MOLECULAR BIOLOGY – DNA replication, transcription SPLICING of Eukaryotic Pre-mRNA The very precise removal of non protein coding intron derived sequences from pre-mRNAs (N.B. genetic code) is catalysed by the multiple subunit containing complex called the ‘SPLICEOSOME’ Pre-mRNA Spliceosome The subunit composition of the spliceosome changes as the splicing of introns progresses The main class of subunit are the ‘small nuclear ribonucleoproteins/ snRNPs (“snurps”)’ snRNPs are complexes of proteins and ‘small nuclear RNA (snRNA)’ There are 5 different snRNPs designated U1, U2, U4, U5 & U6 snRNA Protein The snRNAs in snRNPs permit spliceosome assembly & Recoginse ‘specific splice signals’ within the pre- mRNA by complementary base-paring

46. Figure 6-28 Molecular Biology of the Cell (© Garland Science 2008) snRNAs of snurps recognize 3 types of splice signal in the pre-mRNA 5’ splice site ‘branch site’ 3’ splice site MOLECULAR BIOLOGY – DNA replication, transcription This adenosine is critical to successful splicing The recognition of these 3 splice signal sequences directs the correct assembly of the spliceosome and the correct joining of the exons

47. Figure 6-26a Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Spliceosome reaction mechanism Cowboy’s lariat 2’ - 5’ phosphodiester bond

48. Figure 6-29 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Where do the snRNPs fit in? N.B. the dynamics in the composition of the spliceosome between catalysing the first and second phosphoryl-transfer reactions

49. Figure 6-30c Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription snRNP & snRNA interactions in the two forms of spliceosome active site Formation of the lariat with the conserved adenosine (A) in the branch site (i.e catalysis of the 2’ -5’ phosphodiester bond) Excision of the lariat and joining of the two exons (i.e. a conventional 3’ - 5’ phosphodiester bond)

50. MOLECULAR BIOLOGY – DNA replication, transcription General splicing video/ tutorial http://bcs.whfreeman.com/thelifewire/content/chp14/1402001.html

51. Figure 6-36 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – DNA replication, transcription Self splicing introns Some lower eukaryotic species e.g. tetrahymena Some fungi and plants species Secondary structure formation within the intron caused by complementary base-pairing between its nucleotides forms inherent enzymatic activities (i.e. ‘ribozymes’) that catalyse the removal of the intron and the joining of exons Unicorporated guanine (G) particpates as a cofactor and intron excised as a linear moleclue As with spliceosome assisted splicing a conserved adenine (A) nucleotide in the intron participates in the reaction and the intron is excised as a lariat

52. Figure 6-31 Molecular Biology of the Cell (© Garland Science 2008) ALTERNATIVE SPLICING MOLECULAR BIOLOGY – DNA replication, transcription Alternative splicing is a mechanism by which one gene can code for more than one version of a protein depending upon which exons make it into the mature mRNA and are translated. Therefore provides an evolutionary mechanism for extra diversity!