1. DNA Technology A.P. Biology Biotech Intro Glowing Fish
Glowing Mouse Mistake

2. What’s Next – Google Brain?

3. Uses of DNA Technology
Find out what genes do (mutate or knock out a developmental gene and see what happens)
Make large amounts of a protein
In-situ hybridization – can tell if an embryo has a defective gene
Diagnosis, treatment, prevention of disease
Study of relatedness of species
Crime Solving

4. DNA Technology Uses Continued
Study gene expression
Study growth and differentiation
Identify recessive alleles
Vaccines (make large amounts of proteins that trigger the immune response
Designer Drugs (anti-fat drugs)
RNAi (blocks translation – find out what a gene does)
Gene Therapy (put genes in somatic or germ cells)
Problems:
How do you introduce it?
How do you control gene expression
How do you get the gene product where it’s needed
May alter other cell functions
Eugenics are a worry (controlling the genetic make-up)

5. Technology #1 – Gene Cloning
Making multiple copies of a gene by putting it in a cell that will replicate it and pass it on to offspring
Although you can make lots of copies of a gene in a tt, it will actually produce the protein if in a cell
To clone a gene you will need: restriction enzymes, a vector, and a host cell

6. Restriction Enzymes naturally used by bacteria to digest foreign DNA
Bacteria methylates its DNA (A&C) to protect itself since methylation prevents DNA digestion
Can buy and use to cut and insert foreign DNA
Cut at palindromic sequences – same forward and back (same 5’-3’ or vice versa)

7. Enzyme
Organism from which derived
Target sequence (cut at *) 5' -->3'
Ava I
Anabaena variabilis
C* C/T C G A/G G
Bam HI
Bacillus amyloliquefaciens
G* G A T C C
Bgl II
Bacillus globigii
A* G A T C T
Eco RI
Escherichia coli RY 13
G* A A T T C
Eco RII
Escherichia coli R245
* C C A/T G G
Hae III
Haemophilus aegyptius
G G * C C
Hha I
Haemophilus haemolyticus
G C G * C
Hind III
Haemophilus inflenzae Rd
A* A G C T T
Hpa I
Haemophilus parainflenzae
G T T * A A C
Kpn I
Klebsiella pneumoniae
G G T A C * C
Mbo I
Moraxella bovis
*G A T C
Pst I
Providencia stuartii
C T G C A * G
Sma I
Serratia marcescens
C C C * G G G
SstI
Streptomyces stanford
G A G C T * C
Sal I
Streptomyces albus G
G * T C G A C
Taq I
Thermophilus aquaticus
T * C G A
Xma I
Xanthamonas malvacearum
C * C C G G G

9. Cloning Vectors Something to carry gene so it gets copied
a. Phages (as the phage replicates inside the bacteria so does the added gene and it spreads to other bacteria) – holds up to 25kb of DNA
b. Plasmids – as bacteria reproduce – clones gene within the colony – holds up to 12 kb
c. Retroviruses – have advantage that they can incorporate into the host chromosome in animal cells – Can hold 8-10kb
Yeast artificial chromosomes (YAC’s) – a “fake” chromosome containing foreign DNA with the ability to replicate and undergo mitosis – up to 3000kb
e. Bacterial Artificial Chromosomes (BAC’s) – a fake bacterial chromosome – can hold kb

10. Example of Plasmid

11. Advantages of Plasmids as Vectors
Replicate quickly
Has an origin of replication so is copied and passes to daughter cells
Doesn’t need to enter genome to be copied
Easy to put DNA into plasmids
Easy to put plasmids into bacteria
Can incorporate selection factors to make it easy to find bacteria containing gene of interest

12. Host Can use animal cell, plant cell, yeast cell, or bacteria
Host Can use animal cell, plant cell, yeast cell, or bacteria. Bacteria are the easiest – can get DNA in to the cell easier and they replicate faster
a. Difficult to put DNA into eukaryotic cells (can electroporate, inject the DNA, or attach the DNA to metal beads and shoot through membrane with a gun) – usually use retroviruses! b. Although bacteria are easy to use, you can’t always use them because they don’t have mechanisms to cut out introns and don’t do post- translational modifications – if it needs these modifications to be functional, must use a eukaryotic cell

13. Making Recombinant DNA: How do you clone a gene and how do find the cells that have your gene in them?
1. Cut out your gene of interest and put it in a vector
Digest the plasmid and DNA of interest with same restriction enzyme (now have compatible sticky ends)
Some plasmids will close up without gene
Some plasmids will get the gene inserted

14. How to Clone a Gene Continued
2. Transforming Bacteria (putting the gene of interest with the plasmid into the cell)
Artificial Transformation
Need competent cells (in exponential growth)
Positive ions make cell membranes permeable to DNA
Can also use electroporation, heat shock
Can inject the DNA

15. Gene Cloning Continued
3. Selecting cells that have the gene of interest
Need to know if the gene is inserted into the plasmid and if the plasmid is inserted into the cell
A. To see if colony has the plasmid - Use a plasmid that has antibiotic resistance gene – if plasmid is inserted, it will grow on antibiotic (like ampr – and grow on amp)
To see if plasmid containing colonies have plasmids with the gene of interest:
Use restriction enzymes that cuts in the middle of a color gene like the β galactosidase gene – if inserted the colonies will be white

16. Selection of cells with gene of interest continued
Look for protein products by activity or antibodies
Make probes (short pieces of DNA or RNA that will hybridize (base pair) with the gene of interest – must be radioactive or fluorescent.
Transfer some cells from each colony to filter paper, probe, and then match up colonies

18. Technology #2 – Creating a Genomic Library
Cut whole genome with restriction enzymes – makes sticky ends
Cut plasmids with same restriction enzyme to make matching sticky
Mix the 2 together to get a bunch of plasmids – each with a piece of the genome
Problems with Genomic Libraries
There are many random fragments
Must find the correct gene out of all of the plasmids
Contains introns that bacteria can’t transcribe

19. Making a Genomic Library
Use same restriction enzyme to cut genomic DNA and plasmids to make matching sticky ends

20. Technology #3: Creating a cDNA Library
Create the cDNA (complementary DNA)
Collect all of the mRNA from a cell
Use the enzyme reverse transcriptase (from retroviruses) to copy the mRNA into ds DNA
Cut cDNA with restriction enzymes, cut plasmids with same r.e. and mix together

22. PCR – polymerase chain reaction
Make millions of copies of a single piece of DNA due to primers (must know some sequences flanking the gene)
No need to isolate the gene first
DNA can be old and in very small quantities
Can use for crime detection if only have 1 cell or a small sample
Can use to amplify a gene of interest before making a library so there is a higher concentration of that gene in the library

23. PCR Make primers complementary to the ends of the target sequence
Heat denature the DNA (960)
Cool DNA – primers stick (500)
Heat a little and let DNA polymerase copy the ds DNA (720)
Heat denature again
Cool
Copy, repeat, repeat, repeat
30 cycle makes 200 million copies

24. RT PCR Conversion of mRNA to cDNA by Reverse Transcription
AAAAA
Oligo dT primer is bound to mRNA RT
TTTTT
Reverse transcriptase (RT) copies first cDNA strand
AAAAA
TTTTT RT
Reverse transcriptase digests and displaces mRNA and copies second strand of cDNA RT
AAAAA
TTTTT
Double strand cDNA
Conversion of mRNA to cDNA by Reverse Transcription

25. 50º 96º 50º 72º A. Double strand DNA B. Denature C. Anneal primers
Taq
D. Polymerase binds
72º
Taq

26. First round of cDNA synthesis (4 strands)
Taq
72º
Taq
E. Copy strands
Taq
Taq 1 2 3 4
F. Denature
96º
First round of cDNA synthesis (4 strands)

27. Electrophoresis – Separation of molecules based on electrical charge and size
Uses:
Determine the size of a fragment
Purify plasmids
Identify genes through hybridization/ Diagnosis of genetic disease
Sequencing of a gene
RFLP or VNTR analysis
Paternity testing
Forensics
Chromosome mapping

28. How to pour, load, and run a gel
DNA Electrophoresis
Cut up DNA with restriction enzymes
Load solution of cut up DNA into a well of an agarose gel (porous gel that acts as a sieve)
Apply an electrical current to gel
DNA is negatively charged so it moves to the positive pole.
Since the gel is
porous – the smaller
the piece of DNA –
the faster it moves
so it separates by size
How to pour, load, and run a gel

29. Electrophoresis after restriction digestion
TATCTGGAAGTGGTACC GGAATCTACCGG TATCCGGAAGTGATACCGGAATCTACCGG TATCCGGAAGTGGTATCGGAATCTACCGG

30. Plasmid Purification What a cut vs. uncut plasmid looks like
Circular forms of DNA migrate in agarose distinctly differently from linear DNAs of the same mass. Typically uncut plasmids will appear to migrate more rapidly than the same plasmid when linearized. Additionally, most preparations of uncut plasmid contain at least two topologically-different forms of DNA, corresponding to supercoiled forms and nicked circles. The image to the right shows an ethidium-stained gel with uncut plasmid in the left lane and the same plasmid linearized at a single site in the right lane.

31. Gene Identification If the DNA is purified
Cut the DNA
Run gel (DNA runs toward the + pole)
Stain if have purified gene
CCG↓CGGTAGGAAC CCACGGTAGGAAC
____

32. Gene Identification Using Genomic DNA
Cut the DNA
Run gel (DNA runs toward the + pole)
If stained the gel – big smear of DNA because so many bands
Southern Blot and Probe
Probe = ATCCTT
CCG↓CGGTAGGAAC CCACGGTAGGAAC
____

33. Southern Blotting Denature DNA in gel
Transfer to Nitrocellulose paper by capillary action
Probe with labeled probes
Wash non-specific probe off of paper
Expose to film
Can see if a DNA sequence is there, how many fragments, size of fragments

35. Stain vs. Southern Blot with Genomic DNA

36. Bacterial DNA Cut with a Restriction Enzyme Left is stained/ Right is Blotted and Probed

38. Other Blotting Techniques
Northern – same but using RNA instead of DNA
Western Blotting – electrical transfer of proteins to paper and then using fluorescently or radioactively tagged antibodies to identify protein

39. Alternative for Genetic Disease Diagnosis
Can diagnose diseases without gels using RT-PCR
Collect cells – do PCR of a particular gene
Sequence the gene to see if it is normal or mutated
Aside – can find presence of infectious viruses this way – collect blood or cells and PCR viral genes – run on gel or sequence to see if present

40. RFLP or STR – Paternity Testing and DNA Fingerprinting
RFLP – restriction fragment length polymorphisms
Same as a Southern Blot but usually probe for non-coding regions of DNA that are highly variable (usually these regions are more variable than actual genes)
Usually use multiple probes
STR (short tandem repeats)
Found to be the most variable among humans – makes fragments of different sizes if different number of repeats in satellite DNA

41. DNA Fingerprinting
Must do stats for each probe – what is the % of people that carry each restriction pattern for that probe
The more probes, the more sure you can be that the pattern fits only one person
6 probes is very good
Probe 1 – 1/10 exhibit this pattern
Probe 2 – 1/20
Probe 3 – 1/100
Probe 4 – 1/10
Probe 5 – 1/50
Probe 6 – 1/5
What is the chance that this profile can belong to another person?
1/50,000,000

42. Combined DNA Index System
Run by the FBI
Has over 5 million convicted offender DNA profiles
Mandatory to have DNA profile in CODIS if involved in a homicide or sex crime
Uses 13 different loci to look at 13 different areas for differences in their STR
Creates a unique pattern – 1 in 10 billion have matching pattern

43. Paternity Testing Run standard RFLP analysis using 3-4 probes
The child gets 2 copies of every gene – 1 from each parent
Every allele the child has, must come from the mother or father
Alleged fathers can be excluded but many times if the pattern matches – there is only a 99% chance that he is the father
Usually about 1/100 people have that same pattern

44. Sequencing – Sanger Method
Cut DNA with restriction enzymes
Divide into 4 reaction tubes with all the stuff for replication – (DNA polymerase, ligase, triphosphate nucleotides)
Add ddATP to 1 tube, ddTTP to 1 tube, ddGTP to 1 tube, ddCTP to another tube
As DNA copies, eventually each nucleotide will be “labeled”
Longest fragments at top, smallest at bottom, read from the bottom up
Can do in one tube with fluorescently labeled ddnucleotides – A,T,G,C a different color

45. Instruments for Sequencing

46. New Instruments

47. Microarray Analysis
Gives the ability to compare gene expression between:
Different tissues
Different species
Different stages of development
Cancer vs. non-cancer
Healthy vs. diseased tissue
Procedure:
Make the microarray plate (a robot attaches single stranded pieces of DNA to a glass plate including every gene in the genome)
Make cDNA from all mRNA in each of the two cell types you want to compare
Make the cDNA ss and attach a red tag to the cDNA from one cell type and a green tag to the cDNA from the other cell type
Add the tagged cDNA’s to the plate and let them hybridize
If the spot on the plate is red – it is only expressed in that cell type, if it is green – only expressed in the other cell type, yellow – expressed in both (can even tell concentration differences)

48. Affix ss genes to glass plate Represents all genes of genome
A scanner reads the amount of red fluorescence and green fluorescence separately so you can even tell slight differences in gene expression between the two samples

49. In-Vitro Mutagenesis and Transgenics
Try to get a handle on the function of the gene
Can change a gene and put it in a cell and see the effect on the cell
Can mutate a gene in an embryonic cell and have it try to develop and see what happens in development or in adulthood

50. Cloning of Organisms Destroy DNA in egg
Put DNA from an adult somatic cell into the egg
Put the egg into a female host uterus and develop into a new organism
Most are messed up, develop diseases, or die prematurely
Using DNA with epigenetics (methylation, acetylation patterns) of an adult cell – not of an embryo – affects gene expression!
Embryo farms – grow balls of cells that are clones to use for stem cells to grow new parts – ethical?????

51. Stem Cell Research
Pluripotent embryonic stem cells can become any kind of cell
Adult stem cells become a particular kind of cell or one of a few kinds of cells
Working on taking normal differentiated cells and turning them back into stem cells so can use them to make different kinds of cells (ex. Skin becomes stem cell becomes a neuron)
Ethical issues? – where are we getting them from?
Found some stem cells in brain – can make some new neurons!