1. Plasmid Construction and Purification of Arabidopsis Plantacyanin and Lily Chemocyanin in a Prokaryotic System Suhyen Lee and Brooke Vuong (Aram Nersissian)

2. Outline Purpose Arabidopsis Plantacyanin Lily Chemocyanin Chemotropism Assay pET-3a vector Mechanism-Plasmid Construction -PCR Condition -DNA purification after PCR -DNA digestion and ligation -Transformation -Protein Purification

3. Purpose collaborate with UCR to purify protein so that UCR can use purified protein to do further research on Arabidopsis Plantacyanin and Lily Chemocyanin

4. A basic, 10kD, copper binding …..protein with pI ~10 Characterized by turning blue upon …..binding copper in its +2 oxidation …..state Its function remains unknown Has a single copper binding site …..formed by four ligands: two …..histidines and a cystein …..coordinate equatorially, while the …..fourth, axial ligand, is a …..methionine or a glutamine. The redox potential of plantacyanin …..bound copper varies with the …..hydrophobicity of the axial ligand: …..it increases along with the …..hydrophobicity of the ligand Arabidopsis Plantacyanin http://aggie- horticulture.tamu.edu/faculty/davies /students/ngo/research.html

5. http://www.pnas.org/misc/3800.jpg A member of the plantacyanin family ….copper binding proteins Implicated in Chemotropism in lily ….stigma Essential in pollination: pollen tube ….chemotropism induction Shows 67% sequence similarity to ….plantacyanin Copper binding site: two histidines and ….a cysteine. In place of the axial ligand ….has a non-coordinating, hydrophobic ….leucine residue. Copper binding and other biochemical ….and biophysical properties have not ….been characterized. Lily Chemocyanin

6. Copyright ©2003 by the National Academy of Sciences Kim, Sunran et al. (2003) Proc. Natl. Acad. Sci. USA 100, 16125-16130 Fig. 3. Chemotropism assay showing pollen tube reorientation over time (A and B) and quantification method (C)

7. pET-3a Vector *Designed for cloning and recombinant protein expressions in prokaryotic system, E. Coli. *Utilizes T7 RNA polymerase in the host cell to transcribe and translate. *Has NdeI and BamHI restriction sites which make directional cloning possible *Presence of selective marker, Ampicillin resistant gene

8. Plasmid Construction of Arabidopsis Plantacyanin Primers 1&3 Primer 1: AtPNCNdeMet1 gatcgacatatggccaagggaagaggcagtgc Primer 3: AtPNCNdeMet32 tacgttcatatggcaacgtacacggtcggtgactctgg Reverse Primer: AtPNCBamStop tagaggatccatcaaaccgcggtgactgcgattttc P32 P1

9. Plasmid Construction of Lily Chemocyanin Primer 2: lilChemNdeMet1 atctatcatatggctcagggaagtggcagtgcag Primer 4: lilChemNdeMet30 gtggcccatatggtcgtctataccgtcggcgatggc Reverse Primer: lilChemBamStop gagaggatccttaagctgctgtgactgctatcttcaaacc L30 L1

10. PCR Condition JRAY 94°C 2min 94°C 1min 50°C 1min 72°C 2min 72°C 10min 4°C 99hr N2 94°C 2min 94°C 1min 50°C 1min 72°C 4min 72°C 10min 4°C 99hr 30X *Reaction program Jray was the first program that I used. Using Jray program yielded product, yet the size of the DNA was incorrect. *Reaction program N2 is 60min longer than Jray and using this program yielded right size DNA

11. DNA Purification after PCR Agarose Gel Electrophoresis Low Melting Agarose Gel Electrophoresis Phenol-Chlorform Extraction Cold Ethanol Precipitation DNA is in aqueous phase in phenol-chloroform extraction After ethanol precipitation, DNA is in the pallet

12. DNA Digestion & Ligation Digest DNA with restriction enzyme, NdeI & BamHI with NEB buffer #2 Purify DNA After Restriction Digestion DNA Ligation with pET-3a vector

13. Transformation into Competent Cells

14. Conclusion *P1 expression produced large quantities of recombinant protein *No presence of protein for L1 *Protein in P1 can be purified via glucose shock then ultrafiltration *Protein in L30 should be purified via sonication, 8M urea treatment, and ultrafiltration

15. Protein Purification: Ultrafiltration of P1

16. Protein Purification: L30 purification

17. Further Research Purified proteins will be sent to University of California, Riverside for further study of Lily Chemocyanin

18. Acknowledgement First of all I want to thank God, Dr. Nersissian, Brooke Vuong, and Nicole. And I also want to thank Sam Phang, Penny Saephan, Phuong Minh and Nersissian Lab folks.