2. ABE: Advances in Bioscience Education Dr. Kabi Neupane, Coordinator (co-PI, LCC) Faculty Partners John Berestecky (KCC) Ingelia White (WCC) Janice Ito (LCC) Priscilla Millen (LCC) Catherine Unabia (HPU) David Christopher (PI, UH, Manoa) A workshop bringing together students and faculty to explore research in the molecular and cellular biosciences.

3. Stepping into scientific research What are our goals? What kind of research are we doing ? What is an Arabidopsis plant? What kind of results might you expect? Research philosophy.  From the classroom to the lab bench with intensity.

4. Reach for new learning and knowledge. Goals Take risk, try something new, unfamiliar and break thru the fear barrier. To learn and grow - actively, by doing. Move out of the comfort zone and into the stretch zone.

5. Willing to sail into unchartered waters To discover… make mistakes… …change direction. Research = Stretch Zone:

6. Have FAITH that you can learn from mistakes as you move along. Scientific Research: Learn by Trial and error. Embrace mistakes Persistance is more important than strength

7. Scientific Research: Discover new knowledge. Use tools of molecular and cellular biology to figure out the underlying biochemical processes that control how living cells work. From DNA of genes  to LIFE !

8. GGTTCCAAAAGTTTATTGGATG CCGTTTCAGTACATTTATCGTTT GCTTTGGATGCCCTAATTAAAA GTGACCCTTTCAAACTGAAATT CATGATACACCAATGGATATCC TTAGTCGATAAAATTTGCGAGT ACTTTCAAAGCCAAATGAAATT ATCTATGGTAGACAAAACATTG ACCAATTTCATATCGATCCTCC TGAATTTATTGGCGTTAGACAC AGTTGGTATATTTCAAGTGACA AGGACAATTACTTGGACCGTA ATAGATTTTTTGAGGCTCAGCA AAAAAGAAAATGGAAATACGA GATTAATAATGTCATTAATAAAT CAATTAATTTTGAAGTGCCATT GTTTTAGTGTTATTGATACGCTA ATGCTTATAAAAGAAGCATGGA GTTACAACCTGACAATTGGCT GTACTTCCAATGAGCTAGTACA AGACCAATTATCACTGTTTGAT GTTATGTCAAGTGAACTAATGA ACCATAAACTTGGTCA From DNA sequence (chemical) to Life

9. - Recombinant DNA technology - Biochemistry - Microscopy - Molecular genetics - Computers Tools of molecular and cellular biology Use these tools from an actual research project

10. Complicated name: What does it mean? National Sciences Foundation (NSF) funds ABE: “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks”

11. “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks”

12. Functional Genomics: New field of biological science Rooted in Genetics Genome: all of the genes encoded in DNA in a living organism. Function: Research to figure out what the genes are doing. What proteins do they encode and what jobs in the cell are they responsible for?

13. What jobs do proteins do in a cell? 1. Structure: hold things up 2. Enzymes: activity make and burn energy. Stimulate growth and biomass production. 1000’s different enzymes -> unique activities Figure out their activities. ENZ A -----------> B Where the enzyme is located in the cell? Do they need other protein partners to do their job?

14. “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks”

15. DNA  RNA  PROTEIN |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  Transcribed Translated  Making of a protein: Converting the code in a polymer of nucleic acid to a polymer of amino acid

16. ENZYME: Protein Disulfide Isomerase = PDI Chain of amino acids representing a PDI. Disulfide: “Two sulfurs” The amino acid containing sulfur is cysteine Bond with 2 cysteines | SH | SH | SH

17. ENZYME: Protein Disulfide Isomerase Isomer: Different molecules with same chemical formula. Alter chemical bonding --> different “shapes” --> activities and functions. Isomerase: an enzyme that can make different molecular shapes out of the same substance. Disulfide Isomerase: emzyme that alters molecular shape by acting on the disulfide bonds.

18. PDI can make different protein shapes based on altered disulfide bonding 2 isomers with new activity ! | SH | SH | SH -S- S- | SH -S S- | SH OR

19. “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks

20. Proteins do not do their job unless they are folded correctly So, PDIs fold other proteins correctly in cells. A major responsibility for keeping cells normal, development, metabolism and growth.

21. Protein Disulfide Isomerase (PDI) Gene Family Study all the PDIs in the genome of a small plant. All the PDIs in the same related family. but they go off and have different jobs at various locations in the cell.

22. PDI Protein folding- oxidoreductase PDI = cys Inactive state Active state All proteins have to fold to proper states

23. Oxidation Remove 2 electrons and 2 H+ 2 cysteine sulfhydryls --> make disulfide bridge Reduction --> breaks bridge --> –Add 2 electrons and 2 H+ to the 2 sulfhydryls Chemical Mechanism REDOX

24. But what about plants???? In Yeast and humans - PDIs located in the endoplasmic reticulum (ER)

25. Arabidopsis thaliana Plants

26. First plant to have its genome completely sequenced – Smallest Plant Genome known -> 26,000 genes but makes a plant!! – 40 days from seed to seed. – Easily genetically engineered. – Easy to knock out genes to see what they do. Arabidopsis

27. Primary structure of a generic PDI Signal sequence Directs a protein to a specific location Thioredoxin domains Contains 2 cysteines and active catalytic site for oxidation-reduction and folding of proteins ER retention motif KDELC--C

28. Research activities of workshop Learn some recombinant DNA methods Map genes that have been tagged by a T-DNA Learn PCR and RT-PCR Isolate proteins from leaves and detect proteins using antibodies Use a microscope to find where PDIs and green fluorescent protein are located in the cell.

29. What kind of results might you expect?

30. Any kind of result is a success Learn by doing !!! Have fun while you learn ! Nothing has to work perfectly to be a valuable learning experience.

31. M 1-a 1-b 3- Ⅰ 3- Ⅱ 3- Ⅲ 4- Ⅰ 4- Ⅱ 4- Ⅲ W.T T-DNA Mapping

32. Fluorescence microscopy uses high energy blue - UV light to excite the sample, which emits light at a lower energy Chlorophyll fluoresces red

33. Green fluorescent chemical attached to an antibody that binds to a chloroplast PDI

34. My first attempts at preserving tissue for transmission electron microscopy Sabbatical at University of Colorado 2005-2006

35. High pressure freezing: Plant tissue is flash frozen in a pressure bomb -197 C Water in the tissue is replaced with acetone over 5 day period Acetone saturated tissue is embedded in resin Resin is cut in thin sections, 80 nm thick Add antibody immunolabeling Electron microscope

36. Very Wrinkled

37. Chloroplast Carnage Pretty bad fixation

38. 2nd time: procedures were done poorly, but there is hope… Back to the drawing board to start over. But what to correct? What to do different? Will it improve?

39. When things do not work right, keep moving forward and ignore doubt, pressure and negativism.

40. 3 rd time A charm

41. Excellent preservation And Immunolabeling the 3 rd TIME

42. HIGH MAG

43. RE-search Not search Research time is spent: 70% trouble-shooting 15% success 15% communicating success. Must be repeated

44. ROOT

47. HOOK-o-PLASM

48. PDI in Vacuole

50. 200 nm g CNGC in Golgi Apparatus

51. c 200 nm G PDI in Golgi Apparatus

52. Dividing mitochondria

53. Channel located to the plasma membrane

54. Channel located to the plasma membrane -plasmolysis

55. We learn more from mistakes than successes…