1. Primer Design & Restriction Analysis 3rd December 2014
Carrie Iwema, PhD, MLS, AHIP
Information Specialist in Molecular Biology
Health Sciences Library System
University of Pittsburgh

2. Goals: PCR primer construction & analysis
Restriction digestion & mapping

3. Tools: Primer Analysis & Design Restriction Mapping NetPrimer
Primer3Plus
Primer-BLAST
Restriction Mapping
NEBcutter
Webcutter

4. Primer Analysis & Design
A little something to get you in the mood…

5. Polymerase Chain Reaction (PCR)
1983-Kary Mullis
very simple
exponential amplification
similar to natural DNA replication
The primary reagents, used in PCR are:
Template DNA–DNA sequence to amplify
DNA nucleotides–building blocks for new DNA
Taq polymerase–heat stable enzyme catalyzes new DNA
Primers–single-stranded DNA, ~20-50 nucleotides, complimentary to a short region on either side of template DNA

6. Polymerase Chain Reaction (PCR)
Raise temperature (94-98), denature DNA strands
Lower temp (50-65), anneal primers
Increase temp (72-80), allow time for extensions
Repeat process 25-40X

7. Things to consider for primer design…
Primer-Dimer formation
Secondary Structures in Primers
Illegitimate Priming in Template DNA due to repeated sequences
Incompatibility with PCR conditions
SOURCE: NCBI

8. Primer-Dimer formation
SOURCE: NCBI
homology within a primer (self dimer) or between the sense and anti-sense primer (cross dimer)
bonding of the two primers, increasing primer-dimer artifact and reducing product yields
particularly problematic when the homology occurs at the 3' end of either primer

9. Self Dimer (example) The primer sequence is ATCAGCTGTAGAT
SOURCE: NCBI
internal dimer
3’ end dimer
The primer sequence is ATCAGCTGTAGAT
It forms 2 dimers:
internal dimer where 3rd-8th bases of primer in 5‘3' (starting from 5') bond with 6th-11th bases (starting from 3') when primer is placed in reverse direction
3' end dimer where the last 3 bases (starting from 5') of primer placed in 5‘3' direction bond with last three base (starting from 3') placed in reverse direction.

10. Cross Dimer (example) Sense primer sequence is ATCAGCTGTAGAT
Anti-sense primer sequence is ATAGTGTAGAT
Forms one cross dimer at the 3' end
SOURCE: NCBI

11. Secondary Structure in Primers
Hairpin loop
formed when primer folds back upon itself
held in place by intramolecular bonding
can occur with as few as 3 consecutive homologous bases
stability measured by the free energy
The free energy of the loop is based upon the energy of the intramolecular bond and the energy needed to twist the DNA to form the loop.
If free energy >0, the loop is too unstable to interfere with the reaction
If free energy <0, the loop could reduce the efficiency of amplification

12. Hairpin Loop (example)
SOURCE: NCBI
3’ end hairpin
internal hairpin
The primer sequence is ATCGATATTCGAAGAT
It forms two hairpins:
3' end hairpin where the primer folds back upon itself and first and last 3 bases bond together
internal hairpin where 2nd-5th and 9th-12th bases bond together

13. Basic Primer Analysis & Design Software
NetPrimer
Primer3Plus
Primer-BLAST

14. NetPrimer From PREMIER Biosoft Free Major features:
From PREMIER Biosoft
Free
Major features:
Primer properties: Tm , molecular weight, GC%, optical activity (both in nmol/A260 & µg/A260), DG, 3' end stability, DH, DS, and 5' end DG
Secondary structures: Hairpins, dimers, cross dimers, palindromes, repeats and runs
Primer rating: Quantitative prediction of the efficiency of a primer
Comprehensive report: Prints complete primer analysis for an individual primer or primer pair
Primer pairs: Analyze individual primers or primer pairs
Comprehensive help: Details all the formulas and references used in primer analysis algorithm

15. NetPrimer
Enter sequence here

16. NetPrimer—sense primer

17. NetPrimer—help

18. NetPrimer—theories & formulas

19. NetPrimer—antisense primer

20. NetPrimer—antisense hairpin
The most negative (i.e., most stable) DG is used for calculating the rating.

21. NetPrimer—antisense dimer

22. NetPrimer—cross dimer

23. NetPrimer—3’ & 5’ stability
An ideal primer has a stable 5' end and an unstable 3' end.
Unstable 3’ = limits bonding to false priming sites. The lower this value, numerically, the more liable the primer is to show secondary bands less negative = less false priming.
Stable 5’ = called the GC Clamp, it increases bonding to the target site. The lower this value, numerically, the more efficient is the primer more negative = better bonding.

24. NetPrimer—rating
The rating of a primer provides a quick way of measuring the predicted efficiency of a primer as well as choosing between closely matched primers. The higher the rating of a primer, the higher its amplification efficiency.

25. The higher the rating, the better!
NetPrimer—DG
DG = DH – T * DS = free energy of the primer
DH = enthalpy (internal energy) of primer
T = temperature
DS = entropy (unavailable energy) of primer
Example: primer sequence = ATTCGCGGATTAGCCGAT
DG = cal/mol – ( * -403 cal/°K/mol) = kcal/mol
Rating = [(DG dimer * 1.8) + (DG hairpin * 1.4)]
Example: [( kcal/mol * 1.8) + (-3.28 * 1.4)]
100 + [ ]
76.76
The higher the rating, the better!

26. NetPrimer—practice primers
Rank these primers with attention to rating, 5’ end DG, and 3’ end stability
atgtgcgaggagaaagtgct
acaaaccctggacttgcatc
cgacttgtcccaggtgtttt
ctgaaaccattggcacacac
ggctgtgaacatggacattg
ggctgaagccaaagctacac

27. NetPrimer Ideal for checking primers
To create primers, try Primer3Plus

28. Primer3Plus Select primer pairs to detect a given template sequence
Select primer pairs to detect a given template sequence
Targets and included/excluded regions can be specified
Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Human Press, Totowa, NJ, pp

29. Primer3Plus

30. Primer3Plus
Design PCR primers to amplify sub region of the sequence (600bp-2600bp) with product size 1800bp-2000bp.

31. Primer3Plus—getting started
click here to retrieve sample sequence, then copy/paste into box

32. Primer3Plus
Design PCR primers to amplify sub region of the sequence (600bp-2600bp) with product size 1800bp-2000bp.

33. Primer3Plus
Design PCR primers to amplify sub region of the sequence (600bp-2600bp) with product size 1800bp-2000bp.

34. Primer3Plus—results

35. Primer3Plus—results

36. Primer3Plus—results

37. Primer3Plus—Primer3Manager

38. Primer3Plus—check primers

39. Primer3Plus—check primers

40. Primer3Plus—primer info

41. Primer3Plus—BLAST primers

42. Primer3Plus—BLAST primers

43. Primer3Plus—check w/NetPrimer
How good are these primers? Analyze with NetPrimer!

44. Primer3Plus—NetPrimer sense
Left (F) primer

45. Primer3Plus—NetPrimer sense

46. Primer3Plus—NetPrimer antisense
Right (R) primer

47. Primer3Plus—NetPrimer antisense

48. Primer-BLAST http://www.ncbi.nlm.nih.gov/tools/primer-blast/
Combines primer design (Primer3) and a specificity check (BLAST)
Can also be used w/pre-designed primers
ref:

49. Primer Design Tips
RT-PCR (to avoid unwanted amplification of genomic DNA)
Primer pair should span an intron Or
One of the primers should be at exon-exon junction
SNP issues
May cause mismatch, so pick primers outside of this region
qPCR
Specificity of amplification (amount of PCR product = fluor intensity)

50. click here to retrieve sample sequence, then copy/paste into box
Primer-BLAST
click here to retrieve sample sequence, then copy/paste into box

51. Primer-BLAST results

52. HSLS MolBio Primer Design Tools

53. Finding Primer Resources…
search.HSLS.MolBio

54. More Primer Databases

55. Restriction Mapping www.biologyreference.com

56. Restriction Mapping—for your sequence
Determine the # of restriction sites
Determine the nucleotide position of each cut
List the enzymes that do not cut
List the enzymes that cut only once
Graphical representation of the restriction sites
Textual representation of the restriction sites

57. Restriction Mapping Tools
NEBcutter
Webcutter

58. NEBcutter V2.0 From New England BioLabs Free Major features:
Takes a DNA sequence and finds the large, non-overlapping open reading frames using the E. coli genetic code and the sites for all Type II and commercially available Type III restriction enzymes that cut the sequence just once.
By default, only enzymes from NEB are used, but other sets may be chosen.
Further options appear in the output.
Maximum size of input file = 1 MB; maximum sequence length = 300 KB.

59. NEBcutter

60. NEBcutter—program guide

61. NEBcutter

62. NEBcutter—help

63. NEBcutter—getting started
click here to retrieve sample sequence, then copy/paste into box

64. NEBcutter—restriction map

65. NEBcutter—cutters

66. NEBcutter—zoom in

67. NEBcutter—zoom in more

68. NEBcutter—zoom in more

69. NEBcutter—custom digestion
Get digestion map with SmlI and XbaI

70. NEBcutter—select enzymes

71. NEBcutter—custom digestion map
View gel

72. NEBcutter—agarose gel view

73. NEBcutter—ORF sequence
Find restriction enzymes that will excise the selected portion of the sequence.

74. NEBcutter—ORF sequence

75. NEBcutter—flanking sites

76. NEBcutter—ORF sequence

77. NEBcutter—silent mutagenesis

78. NEBcutter—excise a user-defined sequence

79. NEBcutter—excise a user-defined sequence

80. NEBcutter—enzyme information

81. NEBcutter—enzyme information

82. NEBcutter—REBASE enzyme page

83. REBASE—the restriction enzyme database

84. NEBcutter—enzyme information

85. NEBcutter—methylation sensitivity

86. NEBcutter—generate a vector map

87. NEBcutter—generate a vector map

88. NEBcutter—generate a vector map

89. Sample DNA Sequence You have cloned this mouse sequence:
TGCAGTTTCTATGCAGTTGGTAAAAAGATGCAAAGGAGATGGGAAGGTTGGGAAGGTAAGCCCCACCTCT GAGAACAGAGGCTGGGGTCCAGGCCTGTGGGTGCAAAGGTGCCTCAGCATAGCCAGCATCAGCACACGCA AACCCACTGCCCAAATTTGGGCTCAGGGTTGGCCATTTGCTAGTTCTGCTGCCCTCTTAAGATCTGACTG CCAAATAAATCATCCTCATGTCC ATTGGCGGATCCTGACTACACGCTGTCTTTCTGGCGGAATGGGAAAGTCCAGCACTGCCGCATCCACTCCCGGCAGGATGCT GGGACTCCTAAGTTCTTCTTGACAGATAACCTTGTCTTTGACTCTCTCTATGACCTCATCACACATTATC AGCAAGTACCCCTGCGCTGCAATGAGTTTGAGATGCGCCTTTCAGAGCCTGTTCCACAGACGAATGCCCA TGAGAGCAAAGAGTGGTACCACGCAAGCCTGACTAGAGCTCAGGCTGAACATATGCTGATGCGAGTGCCC CGGGATGGGGCCTTCCTGGTGCGGAAACGCAATGAGCCTAACTCATATGCCATCTCTTTCCGGGCTGAGG GAAAGATCAAGCACTGCCGAGTACAGCAGGAAGGCCAGACAGTGATGCTGGGGAACTCTGAGTTTGACAG CCTGGTTGACCTCATCAGCTACTATGAGAAGCACCCCCTGTACCGCAAAATGAAGCTACGCTACCCCATC AACGAGGAGGCACTGGAGAAGATCGGGACAGCTGAACCCGATTATGGGGCACTATACGAGGGCCGCAACC CTGGTTTCTATGTGGAGGCAAACCCTATGCCAACTTTCAAGTGTGCAGTAAAAGCCCTCTTCGACTACAA GGCCCAGAGAGAGGATGAGCTGACCTTCACCAAGAGTGCCATCATCCAGAATGTGGAAAAGCAAGATGGT GGCTGGTGGCGAGGGGACTATGGTGGGAAGAAGCAGCTGTGGTTCCCCTCAAACTATGTGGAAGAGATGA TCAATCCAGCAGTCCTAGAGCCTGAGAGGGAGCACCTGGATGAGAACAGCCCACTGGGGGACTTGCTGCG AGGGGTCTTAGATGTGCCAGCTTGTCAGATCGCCATCCGTCCTGAGGGCAAAAACAACCGGCTCTTCGTC TTCTCCATCAGCATGCCATCAGTGGCTCAGTGGTCCCTGGATGTTGCAGCTGACTCACAGGAGGAGTTAC AGGACTGGGTGAAAAAGATCCGTGAAGTTGCCCAGACTGCAGATGCCAGGCTCACTGAGGGAAAGATGAT GGAGAGGAGGAAGAAGATCGCCTTGGAGCTCTCCGAGCTTGTGGTCTACTGCCGGCCCGTTCCCTTTGAT GAAGAGAAGATTGGCACAGAACGTGCTTGTTACCGGGACATGTCCTCCTTTCCGGAAACCAAGGCTGAGA AGTATGTGAACAAGGCCAAAGGCAAGAAGTTCCTCCAGTACAACCGGCTGCAGCTCTCGCGCATCTACCC TAAGGGCCAGAGGCTAGACTCCTCCAATTATGACCCTCTGCCCATGTGGATCTGCGGTAGCCAGCTTGTA GCACTCAATTTCCAGACCCCAGACAAGCCTATGCAGATGAACCAGGCCCTCTTCATGGCTGGTGGGCATT GTGGCTATGTGCTGCAGCCAAGCACCATGAGAGACGAAGCCTTTGACCCCTTTGATAAGAGCAGTCTCCG AGGTCTGGAACCCTGTGTCATTTGCATTGAGGTGCTGGGGGCCAGGCATCTGCCGAAGAATGGCCGGGGT ATTGTGTGTCCTTTTGTGGAGATTGAGGTGGCTGGGGCTGAGTACGACAGCACCAAGCAAAAGACGGAGT TTGTAGTGGACAACGGACTGAACCCTGTGTGGCCTGCTAAGCCCTTCCACTTCCAGATCAGTAACCCAGA GTTTGCCTTTCTGCGCTTTGTGGTGTATGAGGAAGACATGTTTAGTGACCAGAACTTCTTGGCTCAGGCT ACTTTCCCAGTAAAAGGCCTGAAGACAGGATATAGAGCAGTGCCTTTGAAGAACAACTACAGTGAAGACC TGGAGTTGGCCTCCCTGCTCATCAAGATTGACATTTTCCCTGCTAAGGAGAACGGTGACCTCAGTCCTTT CAGTGGCATATCCCTAAGGGAACGGGCCTCAGATGCCTCCAGCCAGCTGTTCCATGTCCGGGCCCGGGAA GGGTCCTTTGAAGCCAGATACCAGCAGCCATTTGAAGATTTCCGCATCTCGCAGGAGCATCTAGCAGACC ATTTTGACAGTCGGGAACGAAGGGCCCCAAGAAGGACTCGGGTCAATGGAGACAACCGCCTCTAGTCAGA CCCCACCTAGTTGGAGAGCAGCAGGTGCTGTCCACCTGTGGAATGCCATGAACTGGGTTCTCTGGGAGCT GTCTACTGTAAAGCCTTCTTGGTCTCACAGCCTGGAGCCTGGATTCCAGCAGTGAAGGCTAGACAAAACC AAGCCATTAATGATATGTATTGTTTTGGGCCTCCCTGCCCAGCTCTGGGTGAAGGCAAAAAACTGTACTG TGTCTCGAATTAAGCACACACATCTGGCCCTGAATGTGGAGGTGGGTCCTTCCATCTTGGGCCAGGAGTA GGGCTGAAGCCCCTTGGAAAGAGAAGTTGCCTCAGTTGGTGGCATAGGAGGTCTCAAGGAGCTGCTGACA CATTCCTGAAAGAGGAGAAGGAGAAGGAGGAGGAGCCTTGGTGGGCCAGGGAAACAAAGTTTACATTGTC CTGTAGCTTTAAAACCACAGGGTGAAAGAGTAAATGCCCTGCAGTTTGGCCCTGGAGCCAGGACAGAGGA ATGCAGGGCCTATAATGAGAAGGCTCTGCTCTGCCCATGGAGGAAGACACAGCACAAGGGCACATTGCCC ATGGCTGGGTACACTACCCAGCCTGAAAGATACAGGGGATCATGATAAAAATAGCAGTATTAATTTTTTT TTCTTCTCAGTGGTATTGTAACTAAGTTATTCTGTCCTGCTCCTCACCTTGGAAGGGAAGACCCAGCACA GAGCCTTTGGGAACAGCAGCTCTATGGGGTGTTGTACTGGGAGAGGGCACTGTCAAGAAGGGTGGAGGGG CAGGAAGAGAGAAGAGCAATGTCTACCCTGGTGAGCTTTTTTGTTTTTATGACAAAGACGACTCGATATG CTTCCCCTTAGGAATGGAGATATAGGTAAGTGGAGTCAGGCAGTAGGTACCAAATTAAGCTGCTGCTTGG TGCAGTTTCTATGCAGTTGGTAAAAAGATGCAAAGGAGATGGGAAGGTTGGGAAGGTAAGCCCCACCTCT GAGAACAGAGGCTGGGGTCCAGGCCTGTGGGTGCAAAGGTGCCTCAGCATAGCCAGCATCAGCACACGCA AACCCACTGCCCAAATTTGGGCTCAGGGTTGGCCATTTGCTAGTTCTGCTGCCCTCTTAAGATCTGACTG CCAAATAAATCATCCTCATGTCC
You have cloned this mouse sequence:
Answer the questions on the following page using NEBcutter.

90. Sample Exercises What is the %GC content of this Sequence?
How many restriction enzymes cut this sequence only once?
If you cut the sequence with Kpn I and Hinc II, how many DNA fragments will be generated?
How many open reading frames (ORF) are present?
Find the restriction enzymes with compatible ends that can be used to excise the largest ORF.

91. Sample Exercises Hints (NEBcutter)
What is the %GC content of this Sequence?
See top left of page (after entering sequence info)
How many restriction enzymes cut this sequence only once?
Select for single cutters
If you cut the sequence with Kpn I and Hinc II, how many DNA fragments will be generated?
Select Custom digest, then View gel
How many open reading frames (ORF) are present?
Select ORF summary
Find the restriction enzymes with compatible ends that can be used to excise the largest ORF.
Select the ORF, then locate multiple cutters, cut positions

92. Webcutter 2.0
Free
Major features:
Rainbow cutters Highlight your favorite enzymes in color or boldface for easy at-a-glance identification
Silent cutters Find sites which may be introduced by silent mutagenesis of your coding sequence
Sequence uploads Input sequences directly into Webcutter from a file on your hard drive without needing to cut-and-paste
Degenerate sequences Analyze restriction maps of sequences containing ambiguous nucleotides like N, Y, and R.
Circular sequences Choose whether to treat your sequence as linear or circular
Enzyme info Click into the wealth of references and ordering information at New England BioLabs' REBASE, directly from your restriction map results

93. Webcutter
find alternate versions of the DNA which will translate into the same amino acid sequence, but contains a new restriction site

94. Webcutter
Mutate CCGGGT to CCCGGG to introduce Sma I cutting site without changing translation

95. Webcutter—silent mutagenesis
click here to retrieve sample sequence, then copy/paste into box

96. Webcutter—results

97. Webcutter—specific restriction enzymes

98. Thank you! Any questions?
Carrie Iwema Ansuman Chattopadhyay

99. Sequence Manipulation

100. Sequence Manipulation Tools
READSEQ
Sequence Manipulation Suite

101. Format your sequence any way you want
READSEQ
Format your sequence any way you want

102. READSEQ—change formats
click here to retrieve sample sequence, then copy/paste into box

103. READSEQ—FASTAGenBank

104. Sequence Manipulation Suite

105. removes non-DNA characters from text
SMS—filter DNA
removes non-DNA characters from text

106. SMS—reverse complement
converts DNA to its reverse and/or complement counterpart

107. adjusts the spacing of DNA sequences and adds numbering
SMS—group DNA
adjusts the spacing of DNA sequences and adds numbering

108. creates a map of the annealing positions of PCR primers
SMS—primer map
creates a map of the annealing positions of PCR primers

109. locates regions that match a sequence of interest
SMS—DNA pattern find
locates regions that match a sequence of interest

110. finds # of occurrences of each residue
SMS—DNA stats
finds # of occurrences of each residue

111. converts DNA sequence into protein
SMS—translate
converts DNA sequence into protein