1. This presentation was originally prepared by C. William Birky, Jr. Department of Ecology and Evolutionary Biology The University of Arizona It may be used with or without modification for educational purposes but not commercially or for profit. The author does not guarantee accuracy and will not update the lectures, which were written when the course was given during the Spring 2007 semester.

2. A Brief Review of Genes and DNA

3. Genes are DNA Flourescence micrograph of alga Olisthodiscus. Chlorophyll autofluoresces red. DNA stained with DAPI fluoresces white. Chloroplasts and cpDNA Mitochondria and mtDNA Nucleus and nuDNA

4. Genes and Chromosomes in Eukaryotes Human DNA in one genome is ≈ 1 meter long. It is divided into 23 chromosomes. Somatic cells have two sets of 23 23 chromosomes.

5. Genes and Chromosomes in Bacteria gene 1 gene 2 gene 3 cell

6. Some Definitions The phenotype of a cell or organism is determined jointly by the organism’s genotype and environment. The genotype consists of the genes that control the trait of interest. A gene is a segment of a DNA molecule (or RNA in some viruses). The genome of an organism is (i) the sum of all of the DNA in one set of chromosomes (broad sense); (ii) the sum of all of the genes in one set of chromosomes (narrow sense).

7. Electron micrograph Very small circular DNA (this one is knotted!)

8. Original and Space-filling Models Jim Watson, Francis Crick, and their original hand-made model Computer-built space-filling models of side view (left) and end view (right)

9. Structural Models of DNA major groove minor groove Some viruses have a single-stranded DNA genome. Copyrighted figure removed.

10. Structural Models of Nucleotides Remember: A and G are purines, C and T are pyrimidines Purines have short name & long base (2 rings); pyrimidines vice versa You will not be asked to draw these, but should be able to recognize and name them. Copyrighted figure removed.

11. Structural Models of Polynucleotides Note 5’ to 3’ polarity Copyrighted figure removed.

12. Simplifying a Structural Model Copyrighted figure removed.

13. Base Pairs Copyrighted figure removed.

14. DNA Structure: The Final Simplification A gene is a sequence of bases in one strand of DNA. 3' OH – dR – P – dR – P – dR – P – dR – P 5' | | | | T C G A.......... A G C T | | | | 5' P – dR – P – dR – P – dR – P – dR – OH 3’ 3’ T C G A 5’ A G C T AGCT Learn these models and practice drawing them.

15. DNA Structure : The Final Simplification AGCT DNA sequences are written for the strand that has the same sequence as the RNA transcript (“sense strand”). Sequences are written 5’ to 3’.

16. Human  -globin Gene Determines Amino Acid Sequence of  -globin 1 10 20 30 40 50 60 70 80 90 100 AcatttgcttctgacacaactgtgttcactagcaactcaaacagacaccATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGC 101 AAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGgttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggag 201 acagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccacccttagGCTGCTGGTGGTCTACCCTTGGACCCAGA 301 GGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGG TGCCTTTAGTGA 401 TGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAA CTTCAGGgtgagt 501 ctatgggacccttgatgttttctttccccttcttttctatggttaagttcatgtcataggaaggggagaagtaacagggtacagtttagaatgggaaaca 601 gacgaatgattgcatcagtgtggaagtctcaggatcgttttagtttcttttatttgctgttcataacaattgttttcttttgtttaattcttgctttctt 701 tttttttcttctccgcaatttttactattatacttaatgccttaacattgtgtataacaaaagcaaatatctctgagatacattaagtaacttaaaaaaa 801 aactttacacagtctgcctagtacattactatttggaatatatgtgtgcttatttgcatattcataatctccctactttattttcttttatttttaattg 901 atacataatcattatacatatttatgggttaaagtgtaatgttttaaaattttgcatttgtaattttaaaaaatgctttcttcttttaatatactttttt 1001 gtttatcttatttctaatactttccctaatctctttctttcagggcaataatgatacaatgtatcatgcctctttgcaccattctaaagaataacagtga 1101 taatttctgggttaaggcaatagcaatatttctgcatataaatatttctgcatataaattgtaactgatgtaagaggtttcatattgctaatagcagcta 1201 caatccagctaccattctgcttttattttatggttgggataaggctggattattctgagtccaagctaggcccttttgctaatcatgttcatacctctta 1301 tcttcctcccacagCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATC AGAAAGT 1401 GGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAgctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaac 1501 tactaaactgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatttA

17. Two Alleles of Human  -globin Gene One change in position 20 of  -globin gene results in sickle-cell anemia Normal HbA alleleglutamate in  -globin ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCT GTGGGGC Mutant HbS allelevaline in  -globin ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCT GTGGGGC Next we will review how genes replicate, then how we use enzymes to manipulate genes, then how genes determine the sequence of amino acids in proteins.