1. Assessing the Impact of Candidate Gene Variation on Quantitative Phenotypes Dana C. Crawford, PhD University of Washington March 21, 2006

2. C-reactive protein and CRP Importance of C-reactive protein Genetics of C-reactive protein Genetic variation and C-reactive protein

3. C-reactive Protein Pentraxin family of proteins Produced in liver Acute phase plasma protein General marker for infection and inflammation Volanakis 2001

4. Serum CRP and Risk of MI Ridker et al NEJM 1997;336:937-979

5. Willerson, J. T. et al. Circulation 2004;109:II-2-10II- Prognostic value of various cardiovascular biomarkers in healthy women in the Women's Health Study CRP Better Predictor than LDL

6. Lowering CRP Prevents Recurrent Events Ridker et al NEJM 2005;352:20-28

7. The Genetics of C-reactive Protein A Quantitative Trait High heritability (40-60%) CRP located on 1q21-q23 5'5' 3'3' UTR ~1.9kb

8. Sequence variation in CRP 31 SNPs (6.8kb): 30 SNPs in African- Americans 13 SNPs in European- Americans No amino acid changes SeattleSNPs (pga.gs.washington.edu)

9. Population-based epidemiological survey Genotype CRP SNPs Link genotypes to phenotypes Estimate SNP effects controlling for covariates Percentiles of C-reactive protein concentration 0 14 mg/L ??? Ford et al Clin Chem 2003;49:686-690 Are CRP Variants Associated with CRP Levels in the General Population?

10. CDC population-based survey since 1960’s Demographic information Lifestyle questionnaire Laboratory measures (>100) Physical exam NHANES National Health and Nutrition Examination Survey

11. NHANES Participants Non-institutionalized civilians Both Sexes All racial/ethnic groups Ages 2 months to 85+ Regardless of health

12. The Health Examination And The Mobile Exam Center (MEC)

13. Data from NHANES NCHS 2002

14. NHANES III 7,296 DNAs released August 2002: White, not Hispanicn = 2,630 Black, not Hispanicn = 2,108 Mexican-Americann = 2,073 Othern = 348

15. Choosing SNPs for Genotyping Average gene (~30kb) 126 SNPs 46 common SNP (MAF >5%) 5 coding SNPs Crawford, Akey, and Nickerson Ann Rev Genomics Hum Genet 2005;6:287-312 CRP (6.8kb) 31 SNPs 17 common 1 coding

16. Genotype at one site can predict genotype at another site Proportion of sites are correlated Genotypes Are Correlated (aka linkage disequilibrium) “the nonindependence of alleles at different sites.” Pritchard and Przeworski AJHG 2001;69:1-14

17. Choosing tagSNPs for CRP Common SNPs (>10%) LDSelect (r 2 >0.64) 13 SNPs 3 tagSNPs

18. European-AmericansAfrican-Americans tagSNPs are Population Specific

19. tagSNP selection for CRP Synonymous SNP (2667) “Promoter” SNPs (790, 1440) Intron SNP (1919) Downstream SNPs (3872, 5237) 3’ UTR SNP (3006) 6 “cosmopolitan” tagSNPs 1 rare synonymous SNP

20. CRP tagSNP Allele Frequencies European-Americans * Carlson et al AJHG 2005;77:64-77

21. CRP tagSNP Allele Frequencies African-Americans * Carlson et al AJHG 2005;77:64-77

22. CRP tagSNP Allele Frequencies Mexican-Americans * Carlson et al AJHG 2005;77:64-77 r 2 =0.984 r 2 =0.784(r 2 =0.767)

23. 0.21 mg/dL NHANES III: DNA linked to phenotypes

24. Sample Characteristics WhiteBlackMexican (n=2,630)(n=2,108) (n=2,037) % Female 51.5 54.8 48.6 Mean age 42.5 37.1 33.1 Mean BMI 26.1 27.4 26.9 % Current Smokers 28.8 32.0 21.1 Mean CRP 0.38 0.48 0.43 Mean DBP 78.5 80.7 75.1 Mean SBP125.5126.7 119.6 Mean cholesterol198.6193.1 191.3 Mean HDL 49.5 54.2 47.8 Mean LDL122.0116.9 113.9 Mean triglycerides142.9110.7 149.9 Mean glucose 97.2101.4 100.5 Mean HbA 1C 5.35 5.59 5.45

25. Multivariate Model Continuous phenotype ln(CRP) Stratified by race/ethnicity Covariates Sex Age Smoking status ln(BMI) Diastolic blood pressure Glycosylated hemoglobin Lipids [ln(cholesterol), ln(HDL), ln(triglycerides)] Interactions Sex x triglycerides Sex x diastolic

26. Multivariate Single SNP for CRP Dominant model Beta p-value Sample 790 (promoter SNP) AA AT/TT 0.23 <0.0001 Blacks 2667 (synonymous SNP) GG CG/CC -0.12 0.0337 Mexican-Americans 3872 (flanking SNP) GG AG/AA -0.15 0.0005 Blacks 5237 (flanking SNP) AA AG/GG -0.09 0.0012 Blacks Controlling for covariates

27. Multivariate Single SNP for CRP Additive model 1440 (promoter SNP) Beta p-value Sample AA 0.45 0.0339 Whites 0.17 0.0037 Blacks TT 0.33 0.0001 Blacks 0.08 0.0100 Mexican-Americans AC 0.23 0.0004 Blacks AT 0.14 0.0002 Blacks CT 0.07 0.0151 Mexican-Americans CC genotype is REF Controlling for covariates

28. Inferring Haplotypes from tagSNPs Haplotypes: assigning alleles to a chromosome

29. CRP tagSNP Haplotypes 7 SNPs inferred: # haplotypes H White26 0.73 Black25 0.83 Mexican-American19 0.78

30. Common CRP tagSNP Haplotypes (>5% frequency)

31. Beta p-value Sample ATTGCGA (H5 * ) 0.19 0.0020 Blacks 0.10 0.0244 Mexican-Americans TTAGCGA (H6 * ) 0.51 <0.0001 Blacks AAAGCGA (H7 * ) 0.33 0.0256 Mexican-Americans AAAGAGA (H8 * ) 0.20 0.0067 Blacks Multivariate Haplotype Results * Carlson et al 2005 Controlling for covariatesACAGCAA is REF

32. Carlson et al. AJHG 2005;77:64-77 Results Consistent with CARDIA

33. Haplotype Frequencies for CRP WhiteBlackMexican ACAGCCA 0.31 0.20 0.33 (REF) ATTGCGA 0.30 0.12 0.34 (H5) TTAGCGA<0.05 0.17<0.05 (H6) AAAGCGA 0.06 <0.05<0.05 (H7) AAAGAGA<0.05 0.23<0.05 (H8)

34. CRP variance explained by CRP variants % Variance Explained WhiteBlack Mexican Full model18.1 23.8 18.8 -haplotype17.7 21.118.0

35. CRP Associated Haplotypes ACAGCAAATTGCGATTAGCGAAAAGCGAAAAGAGAACAGCAAATTGCGATTAGCGAAAAGCGAAAAGAGA (H6) (H7) (H5) 1440 (H8) 3872 790 (1421) 19193006 REF

36. CRP Associated SNPs in Promoter 790 is a tagSNP for 1421 1421 and 1440 alter transcription factor binding site ecrbrowser.dcode.org

37. Common vs Rare SNPs in CRP Discovery sample identifies common SNPs 48 chromosomes 99% detection rate for MAF >5% Need more to identify rare SNPs 192 chromosomes 99% detection rate for MAF >1% Do rare coding SNPs contribute to CRP levels? No known nonsynonymous SNPs in CRP

38. African-American (n=24) European-American (n=23) Asians (n=24) Mexicans (n=10) Indo-Pakistanis (n=6) And PDR450 (not shown) ~1,000 chromosomes: 68 SNPs 4 synonymous 3 nonsynonymous

39. Rare coding CRP variation Computational Predictions: 2314 Tyr67His Tolerated/benign 2513 Pro133Lys Tolerated/possibly damaging 2612 Gly166Glu Tolerated/possibly damaging

40. 2513 (Pro133Lys) 1 Indo-Pakistani 0 NHANES III 2612 Gly166Glu 1 PDR sample 2 NHANES III Impact of rare cSNPs inconclusive in NHANES III cSNP Frequency in >14,000 chromosomes

41. Summary of CRP Results Rare variant: CRP nsSNPs are rare in general population Common variant: Common CRP SNPs associated with CRP levels CRP haplotypes associated with CRP levels CRP haplotypes account for 2-11% of CRP variation

42. Acknowledgements University of Washington: Debbie Nickerson Mark Rieder Josh Smith Mike Eberle Nickerson laboratory Alex Reiner CDC/NCHS: Geraldine McQuillan Chris Sanders Xiaoting Qin Lisa Mirel NIH/NHLBI Program for Genomic Applications