1. M B G 8 6 8 0 Rui Pires Martins PhD Candidate, CMMG computer applications in molecular genetics

2. before we start… changes to.login file? created two directories in genetics “traces” “class” (or something??) transferred a copy of files to “class” by wsFTP or through Windows Mgb8680 | DNA sequencing

3. DNA sequencing chromatogram/trace data chromas v.1.45 staden suite preGAP4 GAP4 trev spin Mgb8680 | DNA sequencing outline

4. Mgb8680 | DNA sequencing DNA sequencing jargon read a DNA sequence trace a chromatographic representation of DNA sequencing data contig uous sequence several reads with common spans joined together consensus the resulting sequence from several contigs that overlap template “sense” strand complement “anti-sense” strand 5’ ATTGGAGATCCGACTAATCCA 3’ 3’ TAACCTCTAGGCTGATTAGGT 5’

5. Mgb8680 | DNA sequencing DNA sequencing AGTCAGTC TCAGTCAG

6. Mgb8680 | DNA sequencing fluorescent DNA sequencing

7. each nucleotide is colour coded “good” sequence reads have well-defined peaks Mgb8680 | DNA sequencing sequence traces

8. Mgb8680 | DNA sequencing sequence traces “bad” sequence isn’t so pretty and requires some practise to learn to “call” if two peaks overlap, largest peaks “wins”, unless the peak encompasses more than one residue “bad” sequence REQUIRES CONFIRMATION A A T T A T G T A A A T T

9. Mgb8680 | DNA sequencing Chromas v.1.45 basic chromatogram/trace reading/viewing programme for ab1 and scf files freeware, works in Windows environments some limited editing capabilities examples: forward.ab1 & reverse.ab1 Compare to forward.seq and reverse.seq

10. Mgb8680 | DNA sequencing Staden Suite

11. Mgb8680 | DNA sequencing Staden suite very comprehensive suite of programmes for sequence analysis, manipulation and assembly (was?) free to academics preGAP4 processes/manipulates raw data prior to assembly GAP4 (genome assembly) assembles/ manipulates processed reads into contigs; analyzes sequence integrity; organizes sequencing projects trev trace viewing programme; can be used along GAP or on its own.

12. Mgb8680 | DNA sequencing Staden suite examples: lb3.ab1, lb4.ab1, ub3l.ab1, ub3lup.ab1, ub4.ab1, ubml.ab1, ubmup.ab1 vector file: pBSK+antisense5to3 you will learn to read these files into preGAP4; process them; then assemble the files into a contig using GAP4. trev will be used to edit the sequence reads you will also learn to produce a finished sequence file that could be submitted to GenBank

13. Mgb8680 | DNA sequencing assignment 1.Finish the assembly of the 7 files into as long a contig as you can generate. Be sure to edit any sequence ambiguities as you go. Submit a final text file (fastA format) with this sequence. 2.Repeat the assembly. Only this time, shotgun all 7 files at once. What happened? Are there any advantages to the manual process? (HINT: you’ll have to create a new database in Staden to do this) 3.Use one of the trace readers/editors to edit the following residues from reverse.ab1 270 280 290 300 GCCCCTACACTCGNNNGCCTGCCCGCCTCTCAA 4.Assemble the forward.ab1 and reverse.ab1 files into a staden reads database. What is different this time (i.e. do you notice any annotations or tagged regions in the contigs; and if so what?) What advantages can you see to tagging these regions before you try to assemble them? email answers as text to rui@wayne.edu by Sunday night help/questions can also be directed to rui@wayne.edu or through MSN messenger (mutatethis@hotmail.com)