2. Emmanuel Oluseyi Ogunniyi Student no: OGU3752S BSc Pharmacology

3. Introduction Bioinformatics is the study of the basic structure of biological information and biological systems. It brings together systematic biological data handling (e.g.of genomes) with the analytic theory and practical tools of mathematics and computer science. Each member of the team was given the sequence of a fragment of DNA to determine its characteristics.

4. Aim The aim of this project is to use bioinformatics databases to Identify the origin of the given DNA sequence. Determine the EC code, structure and function of the the enzyme that relates to the given DNA sequence. Obtain the potential protein transitional products of a given DNA sequence as well as a reference.

5. Procedure Each member was given a DNA sequence, mine was tatgctcgtgctcttcaatcttctgctatt This sequence was run through various databases so as to obtain the various characteristics of the given sequence. The first database used was the Nucleic Acid Translator database. The results obtained from this database are displayed on the next slide.Nucleic Acid Translator

6. Nucleic Acid Translator This database was used to translate the “unknown” fragment of DNA and to identify the correct reading frame. The database performed a rapid identity search and produced the following translations: »YARALQSSAI Chosen translation »MLVLFNLLL »CSCSSIFCY »NSRRLKSTSI »IAED!RARA »!QKIEEHEH

7. Nucleic Acid Translator Out of the 6 translations, 2 translations had stop codons in them and these were denoted by ! and were ignored. One was pasted into the Owl database search form, and returned exact matches to the peptide. The next procedure was to search the Owl database for the peptide products. The site can be reached by clicking the link above and clicking the owl link in the blue section at the top of the page.Owl database

8. Owl Database The Owl database produced 2 matches:Owl database 4 ALF_TRYBB FRUCTOSE-BISPHOSPHATE ALDOLASE, GLYCOSOMAL (EC 4.1.2.13). - TRYPANOSOMA BRUCEI BRUCEI. 4 A54500 FRUCTOSE-BISPHOSPHATE ALDOLASE (EC 4.1.2.13) - TRYPANOSOMA BRUCEI.

9. Owl Database Both matches were similar, they had the same EC code. The 2 matches were for the same enzyme FRUCTOSE-BISPHOSPHATE ALDOLASE. The EC code was then put into the NCBI Database. And yielded the following results.NCBI Database.

10. NCBI Database The NCBI Database displays the structure of the molecule that had the EC code that was entered. The structure can be obtained by clicking on the top link (1EX5), this displays the MMDB structure summary. The MMDB id and PDB id are displayed at the top of the next page displayed. Clicking on the PDB id takes you to the PDB database.NCBI Database The PDB Database also gave information about the gene and these are displayed on the next slide.

11. PDB Database 4 Title: Fructose 1,6-Bisphosphate Aldolase From Rabbit Muscle. Name: Fructose 1,6-Bisphosphate Aldolase 4 Origin: Trypanosoma brucei brucei.EC Number: 4.1.2.13. Classification: Lyase. 4 Polymer Chains: A, B, C, D 4 Reference: MEDLINE=86055739 [NCBI, ExPASy, Israel, Japan]; PubMed=2998772; Clayton C.E.; "Structure and regulated expression of genes encoding fructose bisphosphate aldolase in Trypanosoma brucei."; EMBO J. 4:2997-3003(1985).

12. PDB Database On the PDB Database click on the view structure link, the page displays the 3D structure that matches the EC code provided. On the right is the structure I obtained. There is also a link to obtaining the skeleton structure (shown on next slide) of the molecule on this page.PDB Databaseview structure

13. Skeleton structure of the enzyme and links. Links: –To view this presentation on the internet.presentation –PDB DatabaseDatabase –NDBI DatabaseNDBI Database –John Mottley’s webpage, this contains links to all the databases.John Mottley’s webpage