1. AFSOR SBIR Phase I Contract Isothermal and Multiplexed DNA Amplification Protocols and their Application to DNA Taggants Eagle Eye, Inc. Proprietary Technology Eagle Eye, Inc. Proprietary Technology Talk by John H Reif President, Eagle Eye, Inc. Phone: 919-493-7978 Email: reif@cs.duke.edu Proprietary to Eagle Eye, Inc.

2. Outline of Talk Introduction to DNA Taggants Overview of Relevant DNA Biotechnology DNA Taggants Applications to Intelligence, Law Enforcement & Customs Prior Experimental Demonstrations of DNA Taggants: Design & Synthesis of DNA Taggants Tagging Methods & Recovery Multiplexed PCR Protocols Prior Demonstrations of Detection of DNA Taggants The Current SBIR Phase I Project The Eagle Eye, Inc Team Design & Synthesis of DNA Taggants Our Isothermal PCR Protocols Colormetric Output Technical Challenges Phase II Plans Applications to Disease Detection Assays Partnering with Larger Biotechnology Companies

3. Brief Review of Relevant DNA Chemistry and Biotechnology. DNA Bases and Strands: The DNA bases are A, T, C, G. The pairs of bases {A, T} and {C, G} are complementary. A single strand of DNA is a sequence of DNA bases, oriented from 5’ end to the 3’ end. An oligonucleotide sequence lists the bases of a single stranded DNA. DNA Synthesis: 10 16 to 10 17 DNA molecules synthesized in 100 nmole scale. Can be ordered from a commercial synthesis company. DNA Hybridization: Two single strands of DNA, of opposite orientation and with complementary corresponding bases, can hybridize into a segment of doubly stranded DNA. The melting temperature T m for the doubly stranded DNA is that temperature where half of all such strands are hybridized. Is increased by approx. 2  C for each additional A-T base pairing and increased by approx. 4  C for each C-G base pairing. PCR amplification: Use repeated cycles of primer extension, each time doubling the number of selected strands

4. Introduction to DNA Taggants Introduction to DNA Taggants Taggants: any substance that can be added to an object or a surface so that the origin of such objects can be traced, or the movement monitored. Example: unique plastics added to explosive compounds to later aid identification of explosive origins. DNA Taggants: Unique combinations of uniquely synthesized DNA that can be added to compounds or the surfaces or objects and/or personnel so that the origin of such objects can be traced, the movement monitored, or networks of interactions mapped. Since the taggants operate on a molecular level they are extremely discreet. A set of DNA taggants working together can represent a unique molecular barcode, increasing the encoding capacity of the taggant system. An Application of DNA Biotechnology Providing Potentially Revolutionary Improvements in Intelligence-gathering and Surveillance Capabilities.

5. Aerosol Dispersal of DNA Taggants Hand held atomizers Aerosol Dispersal of DNA Taggant Illustration of Aerosol Dispersal of DNA Taggant in Open Area http://londonfoggers.com/ Tagging Methods to apply taggants: Pipette loadingPipette loading Aerosols (i.e. atomizers, sprays, explosions)Aerosols (i.e. atomizers, sprays, explosions) Contact with other tagged objects/personsContact with other tagged objects/persons

6. No toxic properties observed in studies in the literature. Possible explanation: - large, diverse environmental DNA indicates that most DNA is nontoxic. Side Benefit: - diffuse quantities of environmental DNA will disguise DNA taggants. Literature on environmental DNA: - approximately 15 microgram of DNA is found per gram of soil. - mostly derived from living or dead bacteria Reference: ANKE HENNE, ROLF DANIEL, RUTH A. SCHMITZ, AND GERHARD GOTTSCHALK, Construction of Environmental DNA Libraries in Escherichia coli and Screening for the Presence of Genes Conferring Utilization of 4-Hydroxybutyrate, APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 1999, p. 3901–3907 Vol. 65, No. 9 Non-Toxicity of DNA Taggants:

7. Sample Recovery Samples can be collected by: Swabbing the surface with a moist buccal swabSwabbing the surface with a moist buccal swab Washing the surface w/ water and collecting liquidWashing the surface w/ water and collecting liquid Sampling the surface of an object that has come in contact with surface in question.Sampling the surface of an object that has come in contact with surface in question. Our Experimental Demonstration of Detection of DNA taggants on various surfaces: Painted surfaces (oil and latex) Metal Wood Plastic Skin Clothes Money

8. Taggant Transferability Material Index of Transferability Dollar bill.61 Metal, steel 1 Paint, oil.82 Paint, latex.84 Paper.73 Plastic, floppy disk.62 Plastic, keyboard.84 We have compared the efficiency a surface transfers taggant by comparing a collected sample from a surface with a known amount of taggant. An index of these efficiencies was created to allow for comparison between surfaces.

9. Advantages to using Synthetic DNA Sequences as Taggants: (1) The relative high stability of DNA (2) The chemical composition of DNA can be readily and easily varied by varying the sequence of the DNA. (3) Established related biotechnology: many different short (< 100 base) strands of DNA can easily be synthesized using automated methods. DNA sequences can be amplified and sensitively detected using the polymerase chain reaction. Theoretically: a single molecule of a particular DNA sequence might be identified. In practice: can detect as few as a dozen per sample using off-the- shelf technologies.

10. Potential Advantages and Applications DNA Taggants Advantages of DNA Taggants: DNA Taggants themselves can exist undetected on surfaces Taggant dispersion can designed so that taggants can be transferred from surfaces upon contact The taggant is itself the amplicon and therefore those who know the exact sequence can amplify the amount of the taggant allowing for secured detection Example of DNA Taggant applications: Prevent forgeries Track origins of objects and/or people Map networks of interactions Authentication of objects and/or personnel Detection of objects that have been tampered with Anonymous and discreet communications

11. Intelligence Applications of DNA Taggants Molecular taggant systems employing a large number of molecular barcodes with rapid and exquisitely sensitive detection capabilities can provide potentially high impact and revolutionary improvements to intelligence-gathering and surveillance capabilities. Typical Scenario Application of a Molecular Taggant System Using DNA Barcodes: Goal: utilize molecular barcodes to map contact networks without alerting suspects to the surveillance. Target: an organization consisting of a network of a few hundred or thousand individuals. Placement of DNA Taggants: covertly placed on the individuals or objects they regularly touch (e.g., documents, doorknobs of buildings and autos). Movement of DNA Taggants: The DNA Taggants are distributed to other individuals and places by contact with the labeled individuals or objects. Cycles of detection: Provide a timely monitoring of contacts between these individuals. After some time duration, samples would be covertly collected from suspected network members (or objects likely to be touched by them) for testing. Determinations: Positive identification of a molecular barcode would indicate the necessity for further monitoring of the suspect, while negative results might release assets for monitoring other suspects. Advantages: The monitoring of such a large number of individuals by conventional intelligence methods would be extremely costly (or impractically asset-intensive) Refinements: Several sub-areas of a contact network can be labeled with different molecular barcodes which can be distinguished from one another during analysis.

12. Intelligence Uses of DNA Taggant Systems: Verification of human assets within organizations Covert determination of networks of personal contacts Map flow of material within and between targeted organizations Internal monitoring and barcoding of materials: Monitor document circulation Monitor access to tagged objects or areas T2T2 T1T1 Opened? T2T2 T1T1 Top Secret Database Computer Used? Who Read This?

13. Some Example Applications of DNA Taggants to Intelligence Example 1: DNA taggants can be introduced onto a suspected terrorist in order to follow the path or associations of the suspect. An individual need not even be specified. An entire area could be covered with a sequence taggant. Everything that moved into and out of that area could be accounted for via detection of the taggant. Example 2: Sequence taggants can be introduced onto an object: Portable computer Diplomatic Pouch Potential bioweapon Applications: identify the provenance of that object identify people that have come in contact with the object

14. Some Example Applications of DNA Taggants to Intelligence Example 3: Agents/Objects can be coated with a known unique taggant or barcode so the authenticity can be determined if later challened Authentication Forgery Prevenation Example 4: A predetermined surface or handshakes can be used to pass along taggant-encoded messages using a molecular codebook Anonymous Communications Discreet Communications

15. Examples of Objects On Which DNA Taggants May be Placed

16. AdamsBennettCampbellDavis SUBJECTS: OBJECTS: A BCD 12 34 Demonstration of Detection of Multiple DNA Taggants:

17. Mapping Acquaintance Networks Label with 1 mg plasmid DNA. DNA still detectable after serial dilution through 6 handshakes. THL, 2002

18. Demonstrated Examples of Use of our Gen3 DNA Taggant System: Computer Use Detection: detection of use of a laptop computer using two taggants: one outside and one inside T2T2 T1T1 Top Secret Database Computer Used?

19. Example Application of our Gen3 DNA Taggant System: Opening detection: detection of opening of a 55 Gal. drum using two taggants: one outside and one inside T2T2 T1T1 Opened?

20. Demonstration of Verification of Human Assets Using one DNA Taggant Agent X ? Personnel can be tagged with a specific taggant (with or without their knowledge) which can then be analyzed and their trust verified (again with or without the knowledge of the test subject).

21. Gen1 DNA Taggants: [widespread use in commercial sector] No amplification DNA molecules used to embed fluorescent dyes for tags of authenticity Gen2 DNA Taggants: [Ellington] Use PCR Amplification Use PCR to identify single known DNA molecules Termed “forensic taggants” in commercial sector Gen3 DNA Taggants: [Reif group in prior work] Use multiplexed PCR Amplification Simultaneously identify many known DNA molecules Gen4 DNA Taggants: [current SBIR] Vastly Improved Portability: Use of Isothermal Detection Protocols Hardened against Counter Measures: Use various methods to protect DNA taggants Historical Overview of DNA Taggant Technology

22. Primarily used for guarding against forgery: Example: to mark sports memorabilia and other valuable objects, Current Drawbacks: most commercially used DNA taggants are NOT amplicons the DNA molecules are just platforms to embed fluorescent dyes used as tags of authenticity. Gen1 DNA Taggants Current Commercial use of DNA Taggants - generally without Amplification

23. Gen2 DNA Taggants: Pioneering Prior Work of Andrew Ellington on DNA Taggants. Designed and synthesized a series of random sequence libraries - up to 10 15 nucleic acid taggants. Assessed the amplification properties of taggants from these libraries -used real-time PCR on the Cepheid SmartCycler, Developed appropriate methods and assays for amplicon taggants, - Detected down to 4 individual molecules Identified how well nucleic acid taggants survive: - on common surfaces: up to 23 days in the context of a plasmid - in soil: up to 14 days in the context of a plasmid, Identified how readily taggants can be detected in soil: - down to 100 individual molecules. Determined ability of taggants to be transferred between individuals: - 1 microgram of plasmid DNA, corresponding to ca. 10 11 molecules - observed detection following six serial dilutions via handshake. We have utilized Ellington’s research on DNA taggant recovery and detection and extended it to a wide variety of conditions relevant to field operations.

24. Our Improved DNA Taggant Technology Used: Novel Protocols Off-the Shelf Biotechnology Provides Fast Detection of Large Numbers of DNA Taggants Typical Examples of Enhanced Capability of our Gen3 DNA Taggant System: Target an organization consisting of a network of a few hundred or thousand individuals Monitoring by conventional intelligence methods would be extremely costly (or impractically asset-intensive). These provided high impact and revolutionary improvements to intelligence- gathering and surveillance capabilities. Our Prior Gen3 DNA Taggants (DARPA/AFSOR funded 2002-2003)

25. Demonstrated DNA Taggant Technology: Developed Algorithms and Software for Design of DNA Taggants Demonstrated DNA Taggant Detection Protocols: Multiplexing use of multiple frequencies Taggant Detection for up to 16 Taggants Taggant Detection with as few as 100 DNA taggant molecules Used Off-the Shelf Biotechnology: The Smart Cycler Tested Aerosol Dispersal Methods for DNA Taggants Demonstrated Example Uses of DNA Taggant System: Opening detection: detection of use of a laptop using two taggants: one outside and one inside Authentication of a person via a DNA taggant Combinatorial use of pairs of k=16 DNA stands to represent k(k-1)/2 = 120 taggants Detection of Taggant residual after sequential chaining of multiple handshakes Detection of DNA taggants on various surfaces: painted(oil and latex) metal, wood, plastic, skin, clothes, money. Our Prior Gen3 DNA Taggant Project Results

26. Our Prior Funding for Gen3 DNA Taggants Previously received funding in 2002-2003 via increment of existing DARPA contract for development of Antiterrorist Technology. Support: Provided for technician and reagents. PI John Reif time donated.

27. Our Prior Gen3 Demonstrations Executed Summary: Experimental demonstrations of molecular taggant systems using synthetic DNA strands as the taggant molecules. Molecular Barcodes: Defined by a subset of these DNA strands types. Tasks Executed: Designed & Synthesized over 16 individual DNA Taggants, defining over 120 distinguishable Molecular Barcodes(pairs) Demonstrated local and remote aerosol dispersal of DNA Taggants Detection of DNA Taggants: Demonstrated: Single and multiple taggant identification Scalability: 120 Molecular Barcodes (pairs) Exquisitely sensitive detection: as small as 100 molecules. Detection of Chained Sequences of Physical Contacts Detection on painted surfaces, metal, wood, human flesh, cloth. Rapid Readout of results: 20 min.. 2 Frequency Multiplexing for Readout Demonstrated Applications to Intelligence & Law Enforcement Identification of an Individual Detection of the Opening of a Sealed Container Detection of the Use of a Portable Computer Identification of Physical Contact over a Contact Chain

28. Our Gen3 Synthetic DNA Taggants. Each DNA strand consists of a single stranded DNA sequence with three non- overlapping subsegments P, Q, R in the 5’ to 3’ direction: 5’-primer segment P (i) the 5’-primer segment P is a prefix subsequence of the DNA strand of approximately 20 bases. 3’-primer segment R (ii) the 3’-primer segment R is a suffix subsequence of the DNA strand with the same length. P and R are used as the primer sites for PCR amplification, probe sequence Q (iii) the probe sequence Q is the remaining middle sequence of the DNA strand. Q is used for annealing with fluorescent probes (TaqMan™ or molecular beacons) to specifically determine the success of the amplification and/or the probe melting temperature. In our initial demonstration of a taggant system with N=64 molecular barcodes, we represented each molecular barcode by a set of four distinct DNA strand types: (i) one distinct DNA strand type will be used for protocols A or A*, and (ii) three DNA strand types will be used for protocols B or B*. 5’3’ Primer PProbe QPrimer R

29. DNA components of Prior Gen3 DNA Taggant system pipi qiqi riri Barcode strand Probe Reverse Primer Forward Primer pipi qiqi _ riri _

30. Biotechnology Overview: Commercial Molecular Probe systems The fluorescent signal is proportional to the number of amplicons. TaqMan™ TaqMan™ Taq DNA polymerase is used to cleave hybridized probes, separating the reporter from the quencher, resulting in a fluorescent signal that is proportional to the number of amplicons. Molecular Beacons: Molecular Beacons: Uses a method based on secondary structure for separating the reporter from the quencher, and again results in a fluorescent signal proportional to the number of amplicons. Intercalating dye such as SYBR Green™: Intercalating dye such as SYBR Green™: A non-sequence dependent dye that binds specifically to doubly stranded DNA, yielding an increase in fluorescence as the amount of PCR product increases.

31. Biotechnology Overview: Fluorophore and Quencher: 1.In order to monitor PCR reactions, molecular beacons should be designed so that they are able to hybridize to their targets at the annealing temperature of the PCR, whereas the free molecular beacons should stay closed and be nonfluorescent at these temperatures. Numerous fluorophores and quenchers are available.

32. Biotechnology Overview: FRET Probes Quencher Fluorophore Bind to Complement Unbound Probe - Without available complementary strand to bind to, probes are held in a hairpin with fluorophore near quencher. Signal is low. Bound Probe - When bound to complementary strand probe extends and quencher is removed from region of fluorophore. Signal is greatly enhanced.

33. Biotechnology Overview: Molecular Beacons 1.Choice of Fluorophore and Quencher 2.Design of Stem Sequence 3.Check Structure http://www.molecular-beacons.org/protocol.html#cap7

34. Biotechnology Overview: The Cepheid SmartCycler™ System used by Our Gen3 DNA Taggant detection system Biotechnology Overview: The Cepheid SmartCycler™ System used by Our Gen3 DNA Taggant detection system URL: http://www.cepheid.com/pages/products.htmlhttp://www.cepheid.com/pages/products.html Has 16 reaction wells where biochemical operations can be executed independently. Capabilities at each reaction well: It can amplify DNA stands containing specified primer sites, using a sequence of PCR cycles that are determined by a computer controller, and with a total amplification time required to yield readily detectable product (amplicon) of approximately 40 minutes. It has an optical readout capability at four standard wavelengths used by fluorescent probes. Can quantify levels of amplicons products in the sample for up to four possible products per reaction well. It also has a capability to determine the melting temperature of the product duplex DNA. Available as a ‘hardened’ machine that can survive in the field. Ruggedized Advance Pathogen Identification Device (R.A.P.I.D System) by Idaho Technologies (URL: http://www.idahotech.com/) has similar capabilities.http://www.idahotech.com/

35. Advanced Technology for Rapid Real Time PCR Brian J. Wendelburg, Cepheid Biotechnology Overview: The Cepheid Smart Cycler ® System

36. Biotechnology Overview: Analysis Once the samples have been collected, they were probed for any known DNA taggant.Once the samples have been collected, they were probed for any known DNA taggant. Detection was achieved by selectively amplifying suspected DNA taggants, through the use of PCR.Detection was achieved by selectively amplifying suspected DNA taggants, through the use of PCR.

37. Our Prior Experimental Demonstrations of Gen3 DNA Taggants: DNA Molecular Barcodes With Rapid Detection. Experimentally Demonstrated fast and exquisitely sensitive DNA taggant detection methodologies at a Usable Moderate Scale: Demonstrated our novel molecular barcode system with: - very rapid and exquisitely sensitive detection capabilities. - 40 minutes for 64 molecular barcodes Used compact, stand-alone, off-the-shelf commercial hardware: - the Cepheid SmartCycler™ system

38. Our Gen3 DNA Molecular Barcodes. Our enhanced molecular taggant systems operates as follows: (a) First, various distinct types of DNA taggant molecules are designed and synthesized. (b) A large number of molecular barcodes are then defined, where each molecular barcode is identified by a subset of the possible types of these taggant molecules. (c) Finally, they provide a capability for rapid and exquisitely sensitive identification of what distinct molecular barcodes are found in a given sample by determination of which taggant molecules are present.

39. Capabilities for Our Prior Gen3 DNA Taggant System: (i) a relative stable tag chemistry (allowing persistence of the molecular tags for considerable periods of time), (ii) a method for synthesis of very large numbers - say, over 10 15 – copies of each type of tag molecule, (iii) a method for exquisitely sensitive and very rapid detection of molecular tags, as few as a hundred molecules detected in less than an hour, (iv) an apparatus for molecular tag detection that is transportable, compact, low power and easily operated, (v) it is difficult for an outside observer to detect the use of taggant surveillance, (vi) and easily scalable to large numbers of molecular barcodes.

40. Gen3 DNA Taggant Overview of our Prior Gen3 DNA Taggant Detection Protocols. Detection Protocol A: Used for determination of all possible N molecular barcodes that are present in a sample. Uses a single unique DNA strand for each of the N molecular barcodes, and so a total of N distinct synthesized DNA strands. Requires N reaction wells of the Cepheid SmartCycler™ system. Improved protocol A*: Reduces the required number of reaction wells to N/4. For N=64, the 16 reaction wells of the Cepheid SmartCycler™ system suffice to execute protocol A* for a given sample. Detection Protocol B: More efficient detection protocols for discrimination of the molecular barcode in the special (but often occurring) case where at most one molecular barcode is present in the sample. Requires log 4 (N) distinct types of DNA strands for each molecular barcode. Makes redundant use of the additional types of DNA strands Only a total of 4log 4 (N) additional types of DNA strands are required for all the molecular barcodes. Uses 3 reaction wells per sample. Improved Protocol B*: Makes even more efficient use of the Cepheid SmartCycler™ system, Use only one reaction well per sample. Can processes up to 16 distinct samples at the same time on a single Cepheid SmartCycler™ system, using its 16 reaction wells. Requirements for Protocols A* and B*: Only use a single Cepheid SmartCycler™system. No other auxiliary steps or equipment are required. Protocols take at most 40 minutes to execute.

41. Our Prior Gen3 DNA Detection Protocols A: Barcode = 1 strand. A: Barcode = 1 strand. N probes. N reactions. N probes. N reactions. A*: Barcode = 1 strand. A*: Barcode = 1 strand. N/4 primer pairs. N/4 reactions. N/4 primer pairs. N/4 reactions. Probe differentiation via 4 dye types. Probe differentiation via 4 dye types. B: Barcode = multiple strands (4). B: Barcode = multiple strands (4). log 4 (N) reactions. log 4 (N) reactions. Identify by 4 distinct melting temps. (T m ) Identify by 4 distinct melting temps. (T m ) B*: Barcode = multiple strands (4). B*: Barcode = multiple strands (4). 1 reaction. 1 reaction. Identify probe by T m and dye type. Identify probe by T m and dye type.

42. Our Prior Gen3 DNA Taggant System: Protocol B Multiple Barcode Strands With Same Primer Pairs Detected by Distinct Melting Temperatures p1p1 q1q1 r1r1 Barcode strand Reverse Primer Forward Primer p1p1 r1r1 _ q2q2 q4q4 q3q3 Strands q 1 - q 4 are distinguished from one another by: melting temperature. THL, 2002

43. Our Prior Gen3 DNA Taggant System: Multiple fluorescent dyes allow simultaneous detection by multiple probes THL, 2002

44. Our Prior Gen3 DNA Taggant Capabilities & Conclusions Our Prior Gen3 DNA Taggant Capabilities & Conclusions Demonstrated Semi-automatic Design of DNA Taggants: requires a few hours by specialized personnel using our software Demonstrated Detection: Detection of 64 DNA Taggants demonstrated 120 Molecular Barcodes (pairs) also demonstrated Demonstrated exquisitely sensitive detection Demonstrated robust to many surfaces Conclusions: Many applications key to intelligence and law enforcement can apply our DNA taggant technology as current scale. Further scaling will also be of use for certain large scale applications

45. Current Phase I SBIR Technical Milestones Improved Algorithms and Software for taggant design. Refinement of software to provide improved predictability and decreased design time for diverse taggant systems to provide operational demonstrations in the field. Develop software to interface with hardware to provide output analysis and advanced taggant design software through more developmental iterations. Experimentally Demonstrate a Portable DNA Taggant system. Develop further multiplexing capabilities and increase scale. Careful refinement of system to enhance detection and specificity. Demonstration of Applications Careful testing to provide evaluation of operational characteristics in a variety of environmental settings. Development of more application protocols to increase field capabilities of taggants. Proprietary to Eagle Eye, Inc.

46. Phase I SBIR Tasks Task 1a : Experimental Demonstrations of Molecular Barcodes With Rapid Detection Task 1a : Experimental Demonstrations of Molecular Barcodes With Rapid Detection demonstrate fast and exquisitely sensitive taggant detection methodologies demonstrate fast and exquisitely sensitive taggant detection methodologies a series of experimental demonstrations of increasing scale. a series of experimental demonstrations of increasing scale. Task 1b: Improvements to Provide Enhanced Performance of the Molecular Barcode Taggant System: Sequence Design Improvements. Use of improved probes for Detection. Improved Multiplexing. Environmental Surface Testing and Optimization. Proprietary to Eagle Eye, Inc.

47. Phase I SBIR Tasks, Continued Task 2a: Investigation of Hardened Taggants Task 2a: Investigation of Hardened Taggants for limiting unintended environmental degradation of DNA Taggants for limiting unintended environmental degradation of DNA Taggants Possible Hardened Taggants to be investigated include: Possible Hardened Taggants to be investigated include: amplicon taggants with terminal modifications, altered backbone chemistry, cyclization, and secondary structure formation. amplicon taggants with terminal modifications, altered backbone chemistry, cyclization, and secondary structure formation. Task 2b: Avoidance of Detection. Task 2b: Avoidance of Detection. The methods being investigated include: The methods being investigated include: burying the primer binding sites in secondary structure, burying the primer binding sites in secondary structure, masking the ends by cyclization, masking the ends by cyclization, the use of non-standard residues, and the use of non-standard residues, and use of oligonucleotide (as opposed to amplicon) taggants. use of oligonucleotide (as opposed to amplicon) taggants. Proprietary to Eagle Eye, Inc.

48. Phase I SBIR Tasks, Continued Task 3: Experimental Methods for Taggant Dispersal and Capture We are making a comprehensive series of experiments to gauge the utility of our various proposed new taggants for field, and will take the following steps in this experimental testing effort: taggant dispersal, taggant dispersal, capture of amplicon taggants, and capture of amplicon taggants, and detection of oligonucleotide taggants. detection of oligonucleotide taggants. Task 4: Improved Portability of the Detection Apparatus. Task 4: Improved Portability of the Detection Apparatus. We are testing two new isothermal detection assays: We are testing two new isothermal detection assays: A method using enzymes An enzyme free method Proprietary to Eagle Eye, Inc.

49. Personnel: SBIR Project Management John Reif, Ph.D, Applied Mathematics and Computer Science President of Eagle Eye, Inc. (also Professor of Computer Science, Duke University) Other Current Related Research: DNA computing and DNA Nanostructures. Responsibilities: Overall project co-ordination and management responsibilities. URL: http://www.cs.duke.edu/~reif/http://www.cs.duke.edu/~reif/ Designer of the DNA taggant detection protocols and isothermal PCR protocol. design of the detection apparatus and software for optimized design of DNA tag sequence PI: Scott Norton, Ph.D, Optical Science 6 years industrial experience in biomedical instrumentation design, specifically in the areas of fluorescent-based assays using nanobarcode particles Responsibilities: Project Principal Investigator Proprietary to Eagle Eye, Inc.

50. Project Personnel: Senior Personnel Thomas LaBean, Ph.D, Biochemistry Research Assistant Professor, Duke University URL: http://www.cs.duke.edu/~thl/http://www.cs.duke.edu/~thl/ Expertise in Biochemistry Responsibilities: Sequence design and optimization of the DNA taggants and DNA detection protocols. Hao Yan, Ph.D, Chemistry Assistant Professor, University of Arizona URL: http://www.cs.duke.edu/~hy1/http://www.cs.duke.edu/~hy1/ Expertise in experimental DNA protocals Responsibilities: Experimental Demonstration of Isothermal DNA Amplification protocol using enzymes Peng Yin, Masters, Biochemistry Design of Enzme-free DNA detection Assay Developed software for optimized design of DNA tag sequences. Amy Murtha, MD Assistant Professor, Duke Medical School Expertise in DNA detection assays and medical applications Responsibilities: oversee Experimental Testing of DNA detection protocols. Proprietary to Eagle Eye, Inc.

51. Project Personnel: Biochemistry Lab Assistants Responsibilities: Experimental Demonstration of Isothermal DNA Amplification protocol Bryan Yonish Senior Lab Technician Natalie Sidberry-Johnson Liping Feng Proprietary to Eagle Eye, Inc.

52. Additional Affiliated Personnel Anne Lazarides, ( technical assistance) Assistant Professor, Duke Department of Mechanical Engineering & Material Science Expertise in Colormetric Detection Methods Proprietary to Eagle Eye, Inc.

53. Multidisciplinary Expertise Required by Project: Biochemistry Techniques: e.g. PCR, Optimization of Enzymic & DNA hybridization Reactions, fluorescent and colormetric readout techniques Newly emerging Biotechnologies: e.g. fluorescent dyes & readers; portable fluorescent reader devices Software, Mathematics, and Statistics: - algorithms and software for combinatorial design of large synthetic DNA libraries developed by the DNA computing community - statistical software used to determine taggant detection and error analysis Proprietary to Eagle Eye, Inc.

54. Eagle Eye’s Isothermal DNA Detection Assays 54 Goal: Ready to use kit to detect trace amount of specific DNA or RNA strand Detection Assay Proprietary to Eagle Eye, Inc.

55. 55 Eagle Eye’s Isothermal First DNA Detection Assay using Enzymes: Our Exponential Amplification Rolling Circle Assay Summary Input: - one primer strand - an exponential number of circle strands - an exponential number of assisting strands Output: - an exponential number of primer strands Time: liner time Methylation protection of circle strands to prevent them from getting digested by endonuclease Proprietary to Eagle Eye, Inc.

56. 56 Eagle Eye’s Exponential Amplification Rolling Circle Assay Circle strand Primer strand (to be detected) Enzyme restriction site Proprietary to Eagle Eye, Inc.

57. 57 Eagle Eye’s Exponential Amplification Rolling Circle Assay Primer strand anneals to circle strand and initiates polymerization Proprietary to Eagle Eye, Inc.

58. 58 Eagle Eye’s Exponential Amplification Rolling Circle Assay Assisting strands annealed to Assisting strand Enzyme cleavage ! Proprietary to Eagle Eye, Inc.

59. 59 Eagle Eye’s Exponential Amplification Rolling Circle Assay Primer strands number multiplied in one round Proprietary to Eagle Eye, Inc.

60. 60 Experimental demonstration Restriction enzyme: Aci I Polymerase: Phi-29 polymerase DNA strands: - Circle strand: 78 nt, with two restriction site, protected by CpG methylation - Primer strand: 28 nt - Assisting strand: 16 nt Eagle Eye’s Exponential Amplification Rolling Circle Assay Proprietary to Eagle Eye, Inc.

61. 61 DNA strands: Set 1 Set 2 Experimental demonstration Eagle Eye’s Exponential Amplification Rolling Circle Assay Proprietary to Eagle Eye, Inc.

62. Eagle Eye’s New Enzyme Free DNA Detection Assay: using DNA Nanostructures for Exponential Signal Amplification John H Reif and Peng Yin Eagle Eye Inc Proprietary to Eagle Eye, Inc.

63. Eagle Eye’s New Enzyme Free DNA Detection Assay: using DNA Nanostructures for Exponential Signal Amplification Proprietary to Eagle Eye, Inc.

64. A + B is stable Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

65. Introduction of I initialize exponential amplification To be detected Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

66. Reactions Initialization: I + A __ > I.A I.A + B __ > I + A.B Amplification: A.B + A __ > A.B.A A.B.A + B __ > 2A.B Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

67. Initialization Step 1: A + I __ > I.A + Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

68. Initialization Step 2: I.A + B __ > A.B + I + + Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

69. Initialization: I + A + B __ > I + A.B + + + Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

70. Initialization: I + A + B __ > I + A.B + + I Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

71. Replication Step 1: A.B + A __ > A.B.A + Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

72. Replication Step 2: A.B.A + B __ > 2A.B + + Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

73. Replication : A.B + A + B __ > 2A.B + + + Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

74. Exponential DNA Detection I A.B I I I 2 T amplification of input stand I = ab after T stages. T stages Eagle Eye’s New Enzyme Free DNA Detection Assay: Proprietary to Eagle Eye, Inc.

75. Experimental demonstration Sequence design: Strand I: 20 bases CGCTCGCTAGGTTGAAGTCA Strand A: 103 bases ATGCAATGAGGGCATAAGCATCTCTGGCCCTCATTGCATTGACTTCAACCTAGCGAGCGAACGTGCCAATT CTGATCTACTGTGTGGTAAACGCTCGCTAGGT Strand B: 135 bases TCCGCGACGATTCATAAGCATCTCTGGAATCGTCGCGGATTTACCACACAGTAGATCAGAATTGGCACGTT CGCTCGCTAGGTTGAAGTCAAACGTGCCAATTCGCTCGCTAGGTTGAAGTCACTGATCTACTGT Native gel electrophoresis FRET detection TAMRA TET Quenched Fluorescence Eagle Eye’s New Enzyme Free DNA Detection Assay Proprietary to Eagle Eye, Inc.

76. 76 Error reduction by logic AND operation using FRET Flourescence TAMRA TET Quenched Fluorescence Only when both strands a AND b are displaced can fluorescence be detected ! Proprietary to Eagle Eye, Inc.

77. 77 TAMRA TET Quenched Fluorescence Only when a AND b AND c AND d are displaced can fluorescence be detected ! Error reduction by logic AND operation using FRET Flourescence Proprietary to Eagle Eye, Inc.

78. Nanosphere's Colorimetric Assay ( Chad A. Mirkin) Nanoparticle probes appear red when suspended in solution Turn blue if a complementary DNA target is present in the sample. Red to blue color change provides a yes/no answer to the presence of a specific DNA target. Avoids need for fluorescent, chemiluminescent, radioactive or electrochemical methods. http://www.nanosphere-inc.com/2_tech/1_nanoprobes.html Elghanian, R.; Storhoff, J. J.; Mucic, R. C.; Letsinger, R. L.; Mirkin, C. A. Selective Colorimetric Detection of Polynucleotides Based on the Distance-Dependent Optical Properties of Gold Nanoparticles, Science, 1997, 277, 1078- 1080. Storhoff, J. J.; Elghanian, R.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L. One-Pot Colorimetric Differentiation of Polynucleotides with Single Base Imperfections Using Gold Nanoparticle Probes, J. Am. Chem. Soc., 1998, 120, 1959-1964.

79. AND Colorimetric Assay Nanoparticle probes appear red when suspended in solution Turn blue if a chain of k complementary DNA targets are present in the sample. Red to blue color change provides a yes/no answer to the presence of a SET of k specific DNA targets. Applications of AND Assay: (1)Reduces rate of FALSE POSITIVES from  to  k for DNA and RNA detection assays. (2)Allow efficient of small number of DNA sequences to represent many possible Taggants: first synthesize 2k distinct DNA sequences use k of these DNA sequences to represent a single Taggant allows use of 2 k Taggants possible Proprietary to Eagle Eye, Inc.

80. Further Technical Challenges for Use of DNA Taggants: Two Significant Challenges To Use of DNA Taggants in Surveillance Applications: (a) Degradation of taggants through harsh environmental conditions. (b) Avoidance of detection through deliberate environmental flooding with DNA sequences designed to mask the signal of detected taggants. A number of methods for overcoming both of these obstacles are to be investigated: Possible enhancement of molecular taggant systems: Generally assumed that sequence taggants will be recovered and amplified. But a sequence taggant could directly trigger a collector or sensor; for example, a single-stranded DNA taggant could activate a molecular beacon.

81. Further Development of Gen4 DNA Taggant Systems: Further Obstacles to Be Overcome The use of DNA taggants in surveillance applications faces two significant obstacles: degradation of taggants through harsh environmental conditions apprehension of taggants by an adversary. To the extent that an adversary can find or identify a taggant, they can potentially destroy, obscure, or even counter the information represented by the taggant. (A)“Hardened” Taggants: Methods for limiting unintended environmental degradation of DNA Taggants amplicon taggants with terminal modifications, altered backbone chemistry, cyclization, and secondary structure formation. (B) Avoidance of Detection: Methods for avoidance of detection of DNA taggants which we will investigate are: burying the primer binding sites in secondary structure, masking the ends by cyclization, use of non-standard residues, and use of oligonucleotide (as opposed to amplicon) taggants. Related Research in DNA–based steganography (Carter Bancroft & John Reif): Carter Bancroft: Use obscuring DNA for avoidance of detection John Reif: Counter-methods for DNA–based steganography

82. Counter-Measures for Molecular Taggant Technologies Various ways to detect and defeat molecular taggant technology. => Will result in methods that would detect and defeat hostile use of molecular taggant technology against US interests. Knowing what sorts of methods can be developed and are effective: => can "harden" implementation of molecular taggant technology against hostile efforts to detect and defeat the molecular taggants to be developed.

83. Counter-Measures for Molecular Taggant technologies Intentional taggant destruction: Acid-Base Nuclease Radiation Intentional taggant masking: Application of taggant analogues to overwhelm signal from suspected surveillance taggant (but requires knowledge of primer binding sequences to be effective)

84. Methods to Detect and Identify Unknown DNA Taggants Direct analysis of suspected taggant sample by mass spectrometry Sequence analysis by exonucleolytic cleavage Amplification and sequencing by ligation of foreign primer binding sites to taggant termini Detection by hybridization to sequencing arrays

85. Detection and Amplification of Unknown DNA Taggants by Primer Ligation Primer O Primer S’ Tailing and/or ligation of synthetic primer binding sites to unknown taggant Amplification and sequencing using new primer binding sites P Q R O S DJK, 2002

86. Hardening DNA Taggants Against Unintended Sequence Detection Use of non-standard bases: defeats hybridization analysis Use of non-standard bases: defeats hybridization analysis Use of non-standard backbones: (eg. PNAs): defeats standard chemical analysis and intentional degradation Use of non-standard backbones: (eg. PNAs): defeats standard chemical analysis and intentional degradation Cyclization: defeats exonucleolytic sequencing and primer binding site ligation; also increases stability and residence time. Cyclization: defeats exonucleolytic sequencing and primer binding site ligation; also increases stability and residence time. Primer binding site masking: defeats detection and amplification by random primer sets. Primer binding site masking: defeats detection and amplification by random primer sets. DJK, 2002

87. Hardening DNA Taggants: Cyclization of Taggants 5’-P-OH OH-3’ DNA Ligase Site P Site R Site P DJK, 2002

88. Hardening DNA Taggants: Masking of primer binding sites by secondary structure P Q R Primer P Primer R’ Heat, Denaturants, Optimized Primer Mixes DJK, 2002

89. (a) Time Stamped DNA Taggants: Label some sites or objects with specifically destabilized DNA taggant whose known rate of degradation could act as a type of time-stamp. The longer the DNA has been exposed to environmental degradation, the shorter the length of taggant template remaining for amplification. Strands could be specifically destabilized on one end of the strand or at incremental points along the length of the strand. Another possible degradation time-stamp: monitor the ratio of two strands, one composed of RNA and one of DNA. RNA is more susceptible to hydrolysis than DNA, so the longer a taggant is exposed the lower would be the RNA/DNA ratio. (b) Triggering Sensors: Enhancement of molecular taggant systems A sequence taggant could directly trigger a collector or sensor; Example: a single-stranded DNA taggant could activate a molecular beacon. Further Improvements to Molecular Taggant Technology JHR & THL, 2002

90. Summary of Major Phase I SBIR Results to Date Major Breakthrough (Proprietary to Eagle Eye, Inc) The current SBIR project has developed an assay for detection of a given segment of DNA or RNA. Our detection assay is novel - it makes use of self-assembling DNA nanostructures and uses no enzymes. But like PCR, our detection assay is exquisite sensitive, requiring only a dozen or so DNA strands in the sample for detection. Advantages over conventional PCR: The assay requires no additional apparatus, so is highly compact and transportable - it requires only a small dipstick. It is isothermal, requiring no temperature cycling, so requires no thermal cycling apparatus.- It uses no enzymes, so no there is no need for refrigeration. The results are indicated visually by a color transition detectable by the human eye, requiring no detection apparatus. Proprietary to Eagle Eye, Inc.

91. Comparison with Other DNA Amplification Systems LCR Detection(Abbott Labs): Uses Thermal Cycling with antibody-antigen reaction to detect ligated probes using fluorescent labels. TMA Detection(GEN-PROBE): Uses Thermal Cycling with Polymerase & Reverse Transcriptase for Amplificatipon SDA Detection(BD Tech): Isothemal. Uses Polymerase in Amplification

92. Phase II Plans Our Overall Phase II goal will be to demonstrate a prototype DNA Taggant Detection/BooeanEvaluation system using an isothermal biochemical protocol using no external control or changes. The detection portion of the system will be able to detect very small amounts of multiple distinct DNA strands. The BooeanEvaluation portion of the system will evaluate a Boolean formula whose Boolean variables each indicate the presence or absent of particular DNA strands. The response of the detection/BooeanEvaluation system will be detectable by visually detectable color change. The BooeanEvaluation capability of the system will allow for significant decrease of false positives, the scaling to large number of Taggants, and additional applications: watermarking authentication, and transduction and information extraction from DNA computations to detectable outputs. Expected customers for the Taggant detection system are the military, intelligence agencies, customs and police forces. The demonstrations will be in a realistic working environments that would be encountered in practice by these customers. The project will also include development of software design tools for the Taggants and detection methods. Proprietary to Eagle Eye, Inc.

93. Potential Customers of DNA Taggants (1) Federal Intelligence and Law Enforcement Agencies: CIA, FBI, DoE, and Homeland Security (Customs & Secret Service), as well internal security branches of other Federal agencies that deal with sensitive material, (2) Armed Forces (Military Intelligence groups within branches of Armed Forces). (3) State and Local Police, (4) Commercial manufacturers Specific Markets & Customers Material distribution and administration systems: the US Armed Forces and commercial manufactures of copyrighted goods, Tamper detection systems ; potential customers: Dept Homeland Security & the Armed Forces, shipping and pharmaceutical companies, Intelligence: CIA, FBI, Secret Service, military intelligence. Proprietary to Eagle Eye, Inc.

94. Potential Phase II Company Partners Geomet Industries, Arlington, VA. (Hank) Contact Person: Henrietta Kulaga. Intestered in applications to Taggants and bioagent detection. Nanosphere Technologies, Northbrook, IL. (founded by Chad Mirkin). They market colormetric spot assays using nanostructures. Contact persons: founder Chad Mirkin and Uwe Muller, VP who is visiting Eagle Eye Nov 11 to discuss possible joint venture and partnering for both Taggants and disease detection. Syngenta, RTP Office, NC. Janis McFarland, Ago Bussiness Manager in discussions with Eagle Eye about applications for both Ago Taggants and disease detection. BD (Beck and Dickerson) Technologies, RTP Office, NC. Prior meeting with Eagle Eye in July, 2004. Currently in discussions with Eagle Eye about possible joint venture and partnering for both Taggants and disease detection. Contact person: Detection demo to be done in November. Glaxo-Smith-Kline, RTP, NC. Contact person: Tadataka (Tachi) Yamada, Chairman, Research and Development. Proprietary to Eagle Eye, Inc.

95. Potential Phase II Institutional Partners NC Biotechnology Center, RTP, NC. They partner with emerging NC small biotech companies. Contact person: Ken Tindell, Senior VP, Science and Business Development to meet with Reif. Virginia Institute of Forensic Science and Medicine, Richamond, VI. They partner with emerging small companies developing products for police and federal law enforcement agencies. Department of Homeland Security, Homeland Security Institute/Threats Division, Arlington, VA. They may partner with us on portable Taggant technology. Contact person: Nancy Forbes, Senior Researcher, MITRE, Arlington, VI. Testing Taggant Technologies. Contact person: Jorden Feidler FBI. Forensic Science Research Center. Contact Person: Mona Thiss, Director, Grants and Research In-Q-Tel, Langley, VI. Partners with small companies on development of technology with applications of interest to CIA. Contact Person: Steve Stassinos CIA, Langley, VI. DS&T: Directorate of Science and Technology, ITIC: Innovative Technology Intelligence CenterNorm Kah, CIA Langley, VI Proprietary to Eagle Eye, Inc.