1. AP Biology 2004-2005 Teaching Biology Through Bioinformatics Real world genomics research in your classroom Kim B. Foglia Division Ave. High School Levittown Stuart M. Brown, PhD Director of Research Computing NYU School of Medicine

2. Bioinformatics 2005-2006 Bioinformatics  Use of computers to analyze genomic data for molecular biology research  basic biological research  medical research  clinical medicine application  taxonomy

3. Bioinformatics 2005-2006 Bioinformatics is a great way to learn biology  Using computers to study primary biological data (genomes, proteins, other databases)  students learn biology as a dynamic process of interpreting complex data  students can reproduce current scientific work & ask new questions  science is no longer just a collection of facts in a textbook, it’s a process of inquiry

4. Bioinformatics 2005-2006 Teaching Biology with Bioinformatics  Bioinformatics tools lead directly to insights about genes, proteins, evolution  “Hey! Most human genes have more bases of introns than they do exons.”  “Hemoglobin sequences show that seals are closer to weasels than they are to whales.”  “Protein shapes determine their function, so small changes can make a big difference.”

5. Bioinformatics 2005-2006 All you need…  Students can work on bioinformatics questions at low cost  only need Internet connected computers  most database tools are free on Internet  unlimited data  GenBank, protein structures, mutations, microarrays, etc.  teacher knowledge & “comfort”  questions to answer

6. Bioinformatics 2005-2006 What we offer…  Teaching modules  inquiry labs  student & teacher lab handouts  supporting teaching resources  PowerPoint presentations  Supplemental skills modules  Download from Web site  http://bio.kimunity.com

7. Bioinformatics 2005-2006 Modules in development  Testing for Sickle Cell Anemia  develop a genetic diagnostic test to screen for disease  Endosymbiosis  evolutionary history mitochondria & chloroplasts  Hemophilia Gene Therapy  build a vector and insert correct gene  Are Seals and Whales Related?  studying evolutionary relationships

8. AP Biology 2004-2005 Sickle Cell Anemia & the Hemoglobin Gene Using Bioinformatics in Medicine

9. Bioinformatics 2005-2006 Sickle Cell Anemia  Most common genetic disease in US  high incidence in African-Americans  affects red blood cell structure & function  single base mutation causing single amino acid change  SNP = single nucleotide polymorphism

10. Bioinformatics 2005-2006 Symptoms  Anemia  jaundice, fatigue, paleness, shortness of breath  Hypoxia (low oxygen) & capillary damage  severe pain in organs & joints  retinal damage (blindness)  Delayed growth  delayed puberty, stunted growth  Infections  more susceptible  depressed immune  death from bacterial infections  Stroke  blocked small blood vessels in brain  primarily in children

11. Bioinformatics 2005-2006 Sickle cell hemoglobin mutant hemoglobin (Hb S)

12. Bioinformatics 2005-2006

13. Bioinformatics 2005-2006 Cell biology  Hb S molecules stick together  form fibers  under low blood oxygen levels  deoxyhemoglobin sickles  distortion of cells from normal round to sickle shape

14. Bioinformatics 2005-2006  Sickle cell mutation  Hb S  changes 6 th amino acid of  hemoglobin chain  normal glutamic acid  valine  Recessive allele  heterozygote  Hb AS, normal, but carrier  homozygote recessive  Hb SS, sickle cell disease  2 sickle cell carriers mate…  each child has 1/4 chance of having the disease Genetics Hb AHb S Hb A Hb S HbAA HbAS HbSS HbAS

15. Bioinformatics 2005-2006 Prevalence in U.S.  Carriers  ~2 million Americans carry sickle cell trait  1 in 14 African-Americans  Disease  ~72,000 Americans have disease  ~1 in every 700 African-American babies born in U.S. has sickle cell disease

16. Bioinformatics 2005-2006 The Malaria Connection  Sickle cell disease is surprisingly common for a potentially lethal genetic disease  Heterozygote advantage  heterozygotes are tolerant of malaria infection & do not suffer symptoms of sickle cell disease

17. Bioinformatics 2005-2006 Malaria

18. Bioinformatics 2005-2006 Prevalence of Malaria Prevalence of Sickle Cell Anemia ~sickle cell movie~

19. Bioinformatics 2005-2006 Public health  Many carriers of this mutant allele are not aware that they have it  at risk of having children with the disease  DNA test for sickle cell allele would benefit public health  genetic counseling  pre-natal testing

20. Bioinformatics 2005-2006  Develop a simple inexpensive DNA test for sickle cell allele  develop DNA probe  test for presence of sickle cell mutation  use bioinformatics tools  online databases of DNA sequences  UCSC Genome Browser  probe design tool  Primer3 Your Assignment

21. Bioinformatics 2005-2006 DNA review  DNA double helix  A–T, C–G  base pair bonds can be broken by heating to 100°C  separate strands  denature, or melt

22. Bioinformatics 2005-2006 5’ 3’ DNA probes  Probe  short, single stranded DNA molecule  mix with denatured DNA  DNA Hybridization  probe bonds to complementary DNA sequence  Label  probe is labeled for easy detection labeled probe genomic DNA GATCAGTAG CTAGTCATC

23. Bioinformatics 2005-2006 GATCCGTAG Designing Probes  Allele specific probes  probes require matched sequences  can detect single base differences in alleles  single mis-matched base near middle of probe greatly reduces hybridization efficiency 5’ 3’ labeled probe genomic DNA X CTAGTCATC

24. Bioinformatics 2005-2006 Dot blot  Genomic DNA  denature DNA  bind DNA from cells on filter paper  DNA hybridization  wash probe over filter paper  if complementary sequence present, probe binds to genomic DNA  expose on X-ray film  dark spots show bound probe

25. Bioinformatics 2005-2006 Get hemoglobin sequence  UCSC Genome Browser  human genome database  http://genome.ucsc.edu/ http://genome.ucsc.edu/  UCSC Genome Browser home page  click on link to Genome Browser  in genome pulldown menu, choose “Human”  for position text box, type “HBB” (hemoglobin  )  hit “submit”

26. Bioinformatics 2005-2006 Genome Browser Results  Listing of genes & sequences in database  Click on “RefSeq” gene for HBB (NM_000518)

27. Bioinformatics 2005-2006 Chromosome view  Position of HBB in genome  at base 5.2 million on chromosome 11

28. Bioinformatics 2005-2006 Change view of chromosome  Move & zoom tools  zoom out ~30x to see more of chromosome 11

29. Bioinformatics 2005-2006 More Hb genes  Cluster of hemoglobin genes on chromosome 11  HBD, HBG1, HBG2 & HBE1  what are these genes?

30. Bioinformatics 2005-2006 Get the DNA sequence  Click on the HBB RefSeq gene  HBB RefSeq summary page

31. Bioinformatics 2005-2006 HBB RefSeq gene summary page  Click on “Genomic Sequence from assembly”

32. Bioinformatics 2005-2006 Formatting the sequence  Sequence Formatting Options  “exons in upper case, everything else in lower case”  hit “submit”  Genomic DNA  lower case = introns  spliced out of mRNA before translation  upper case = exons  translated into polypeptide chain

33. Bioinformatics 2005-2006 HBB DNA sequence >hg16_refGene_NM_000518 range=chr11:5211005-5212610 5'pad=0 3'pad=0 revComp=TRUE ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGgttggtat caaggttacaagacaggtttaaggagaccaatagaaactgggcatgtgga gacagagaagactcttgggtttctgataggcactgactctctctgcctat tggtctattttcccacccttagGCTGCTGGTGGTCTACCCTTGGACCCAG AGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGG CAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTG ATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGT GAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGgtgag tctatgggacgcttgatgttttctttccccttcttttctatggttaagtt catgtcataggaaggggataagtaacagggtacagtttagaatgggaaac agacgaatgattgcatcagtgtggaagtctcaggatcgttttagtttctt ttatttgctgttcataacaattgttttcttttgtttaattcttgctttct ttttttttcttctccgcaatttttactattatacttaatgccttaacatt gtgtataacaaaaggaaatatctctgagatacattaagtaacttaaaaaa aaactttacacagtctgcctagtacattactatttggaatatatgtgtgc ttatttgcatattcataatctccctactttattttcttttatttttaatt gatacataatcattatacatatttatgggttaaagtgtaatgttttaata tgtgtacacatattgaccaaatcagggtaattttgcatttgtaattttaa aaaatgctttcttcttttaatatacttttttgtttatcttatttctaata ctttccctaatctctttctttcagggcaataatgatacaatgtatcatgc ctctttgcaccattctaaagaataacagtgataatttctgggttaaggca atagcaatatctctgcatataaatatttctgcatataaattgtaactgat  first 50 bases are untranslated “leader” sequence  actual protein coding sequence starts at base 51  starting with letters ATG

34. Bioinformatics 2005-2006 Get the mutant sequence  Sickle cell mutation  single base mutation  6th amino acid: glutamic acid  valine  need DNA sequence to design probe  SNPs  single nucleotide polymorphisms  “variations and repeats” section: pack

35. Bioinformatics 2005-2006 SNPs of HBB gene  several SNPs of HBB gene  need mutation in exon  near beginning of HBB protein  rs334 = Hb S mutation

36. Bioinformatics 2005-2006 rs334 Hb S sickle cell mutation  “Sequence in Assembly” = normal sequence  “Alternate Sequence” = sickle cell sequence

37. Bioinformatics 2005-2006 Align Hb A & Hb S sequences  Line up sequences  sequence fragment is enough to design DNA probes for normal & mutant sequences Normal: catggtgcacctgactcctgAggagaagtctgccgttactg HBB: ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG Mutant:catggtgcacctgactcctgTggagaagtctgccgttactg

38. Bioinformatics 2005-2006 Designing the probe  Primer3  free on Web from MIT http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi  powerful tool for primer design  paste in sequence fragment

39. Bioinformatics 2005-2006 Allele specific probes  Need 2 probes  normal allele probe  sickle cell allele probe  choose hybridization probes  Customize probes  12-16 bases  40°-60°C longer probes are stable at higher temperatures

40. Bioinformatics 2005-2006 Your probes…  Ready to order!  Place an order at your local DNA lab!

41. AP Biology 2004-2005 Extra credit Advanced Assignments

42. Bioinformatics 2005-2006 Advanced Assignment #1  Use the Web to research other “allele specific” genotyping methods  ligase chain reaction  primer extension  TaqMan  Design probes for one of these alternate technologies

43. Bioinformatics 2005-2006 Advanced Assignment #2  PCR & Restriction Digest  pre-natal testing  for small samples it is necessary to use PCR to amplify the amount of genomic DNA before testing  once you have a PCR-amplified DNA fragment of a gene, a restriction enzyme may be able to distinguish between alleles  design PCR primers & find restriction enzyme that will locate sickle cell allele  design with Primer3

44. Bioinformatics 2005-2006 Restriction enzymes  NEBcutter  http://tools.neb.com/NEBcutter2 http://tools.neb.com/NEBcutter2  New England BioLabs  screens DNA sequence against all restriction enzymes  Webcutter  similar program  http://www.firstmarket.com/cutter/cut2.html http://www.firstmarket.com/cutter/cut2.html

45. Bioinformatics 2005-2006 NEBcutter

46. Bioinformatics 2005-2006 Advanced Assignment #3  Population genetics  determine if sickle cell allele is in Hardy- Weinberg equilibrium in the U.S. African-American population  ~2 million Americans carry sickle cell trait  1 in 14 African-Americans is a carrier  ~1 in every 700 African-American babies born in U.S. has sickle cell disease