Presentation is loading. Please wait.

Presentation is loading. Please wait.

Genetics of Cancer Part 2 - January 23, 2007. Review Two mutations must occur:

Similar presentations


Presentation on theme: "Genetics of Cancer Part 2 - January 23, 2007. Review Two mutations must occur:"— Presentation transcript:

1 Genetics of Cancer Part 2 - January 23, 2007

2 Review Two mutations must occur:

3 Review Two mutations must occur: Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division

4 Review Two mutations must occur: Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division Tumor Suppressor Gene inactivated (brakes disconnected from accelerating car)

5 What else must happen? External controls overcome Cells not limited by:  Crowding  Lack of attachment  Lack of nutrients  (remember “angiogenesis”?)

6 What else must happen? Telomerase must be present to create cellular immortality.

7 What else must happen? Telomerase must be present to create cellular immortality. Most human cells divide 50-100 times before entering G 0 permanently or committing cell suicide (apoptosis)

8 Telomerase OK, but…how does a cell know it has divided 50-100 times???

9 Telomerase OK, but…how does a cell know it has divided 50-100 times??? Tips of chromosomes are capped with a sequence of bases (TTAGGG) repeated 1000’s of times. Each division removes 50-200 of these bases

10 Telomerase, con’t TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG

11 Shortening… TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG

12 Shortening, until… TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG

13 Shortening, until… TTAGGGTTAGGGTTAGGG It can’t divide any longer!

14 Stem Cells Stem cells produce cells (sex cells, blood, hair) that need to be replaced regularly - must keep dividing!

15 Stem Cells Stem cells produce cells (sex cells, blood, hair) that need to be replaced regularly - must keep dividing! Telomerase is an enzyme that rebuilds the telomeres (adds TTAGGG) If telomeres don’t get shorter, cells don’t get older

16 Back to cancer cells… Cancer cells have a mutation that allows the production of telomerase. Leads to cells being immortal that should die out. Telomerase = gas tank!

17 Metastasis must spread cancerous cells Cells spread via the circulatory or lymphatic system 99% of cancer cells die en route, but some lodge in capillaries or lymph nodes Cancer cells can break down material between cells to travel within tissues, leading to new colonies

18 Cancer and inheritance Two-hit hypothesis: TSG’s are inherited in pairs and both copies must be mutated

19 Cancer and inheritance Inherited one mutant TSG? You’re prone to developing cancer early in life (middle age or earlier) Two good TSG’s? Cancer may come later in life, if at all.

20 Cancer and inheritance Inheritance is only a small part of developing cancer (colon cancers are inherited 15% of the time, breast 7%) Environmental factors often more important determinant

21 p53 “THE GUARDIAN OF THE GENOME”

22 p53 “THE GUARDIAN OF THE GENOME” Your primary TSG Mutated in 55% of all cancers

23 p53 Activated when DNA damage is bad 1st - Halts cell cycle

24 p53 Activated when DNA damage is bad 1st - Halts cell cycle 2nd - Starts DNA repair and restarts cell cycle if successful

25 p53 Activated when DNA damage is bad 1st - Halts cell cycle 2nd - Starts DNA repair and restarts cell cycle if successful 3rd - Causes apoptosis (cell suicide) if repair unsuccessful

26 Review Gas pedal =

27 Review Gas pedal = protooncogene

28 Review Gas pedal = protooncogene Brake =

29 Review Gas pedal = protooncogene Brake = tumor suppressor gene

30 Review Gas pedal = protooncogene Brake = tumor suppressor gene Gas tank =

31 Review Gas pedal = protooncogene Brake = tumor suppressor gene Gas tank = Telomerase (adds telomeres TTAGGG)

32 Review Two-hit hypothesis?

33 Review Two-hit hypothesis = BOTH copies of a TSG must be mutated

34 Review Two-hit hypothesis = BOTH copies of a TSG must be mutated Guardian of the cell?

35 Review Two-hit hypothesis = BOTH copies of a TSG must be mutated Guardian of the cell = p53

36 Review Two-hit hypothesis = BOTH copies of a TSG must be mutated Guardian of the cell = p53 Cell suicide?

37 Review Two-hit hypothesis = BOTH copies of a TSG must be mutated Guardian of the cell = p53 Cell suicide = apoptosis


Download ppt "Genetics of Cancer Part 2 - January 23, 2007. Review Two mutations must occur:"

Similar presentations


Ads by Google