1. ASSOCIATION OF MCP-1/CCL2 GENE POLYMORPHISM WITH ACUTE GRAFT VERSUS HOST DISEASE AFTER ALLOGENEIC HAEMATOPOIETIC STEM CELL TRANSPLANTATION Z. Ambruzova 1, B. Vidan-Jeras 3, L. Raida 2, F. Mrazek 1, M. Jeras 3, E. Faber 2, A. Stahelova 1, J. Pretnar 4, K. Indrak 2, M. Petrek 1 1 Laboratory of Immunogenomics, Dept. of Immunology, 2 Department of Haematooncology, Medical Faculty Palacky University and University Hospital Olomouc, Czech Republic, 3 Blood Transfusion Center of Slovenia, 4 Department of Haematology, University Clinical Centre Ljubljana, Slovenia Supported by Czech Govt. Funding MSM 6198959205 and IGA MZCR NR9099

2. BACKGROUND  acute graft versus host disease (aGVHD) is the most serious complication of the allogeneic haematopoietic stem cell transplantation (aHSCT) and substantially influences its outcome  chemokines are molecules implicated in the activation phase of aGVHD; they attract donor T cells activated in lymphoid tissues to the target organs which leads to the clinical manifestation of aGVHD (Wysocki 2005)  functional polymorphisms of the chemokine genes may affect migration and distribution of donor T cells in the host tissues and, therefore, might influence occurence and severity of aGVHD

3. MONOCYTE CHEMOATTRACTANT PROTEIN-1(MCP-1)  MCP-1 (CC chemokine ligand 2, CCL2) acts via interaction with the chemokine receptor CCR2  MCP-1 plays as a potent attractant of mononuclear cells and is implicated in the recruitment and migration of leukocytes to the sites of inflammation  variations in MCP-1 expression have been studied in many diseases associated with organ inflammation (Petrek 2002, Arakelyan 2005)

4. MCP-1/CCL2 GENE POLYMORPHISM  CCL2 gene is polymorphic and its genetic variants can modulate MCP-1 production  functional single nucleotide polymorphism (SNP) in distal regulatory region at position -2518 may affect the level of MCP-1 protein expression (G allele is associated with increased MCP-1 secretion in vitro) (Rovin 1999)  several studies of the impact of MCP-1 gene variants on posttransplantation outcome after organ transplantation were performed (Lacha 2005, Schröppel 2002)

5. AIM OF THE STUDY to investigate if there exists an association between: MCP-1/CCL2 gene polymorphism -2518 A/G occurence of acute GVHD after aHSCT

6. INVESTIGATED SUBJECTS Number of donor-recipient pairs 141 center Olomouc88 center Ljubljana53 Median age, years (range) Donor HLA compatibility patients 40 (17-64) identical141 donors 41 (19-69) mismatched 0 Recipient sex Donor type female 58 sibling 107 male 83 other related donor 4 Diseases unrelated 30 acute leukemia (AML, ALL) 79 Graft source chronic leukemia (CML,CLL) 25 PBSC124 NHL 14 BM 17 other 23 Acute GVHD Conditioning regimen Grade 0-I 89 non-myeloablative55 Grade II 35 myeloablative86 Grade III 8 Sex of donor and recipient Grade IV 9 male with female donor31 all others combinations110

7. METHODS 1. MCP-1/CCL2 -2518 SNP genotyping Polymerase Chain Reaction with Sequence Specific Primers (PCR-SSP) Primers designed according to the reference CCL2 gene sequence MCP-1-2518 A/G (rs1024611) Specific 1 (wild type) *A: 5´GTGGGAGGCAGACAGCTA3´ Specific 2 (mutant type) *G: 5´GTGGGAGGCAGACAGCTG3´ Constant: 5´TGAGTGTTCACATAGGCTTC3´ 2. Statistics Conformity to the Hardy-Weinberg equilibrium: Chi-square test Differences between allele and genotype frequencies: Chi- square test with Woolf-Haldane correction in cases of small numbers

8. RESULTS  overrepresentation of MCP-1-2518*G allele among recipients with aGVHD (28%) compared to those without aGHVD (17%, p=0.03) (Table 1, Figure 1)  recipients carrying MCP-1-2518*G allele developed aGVHD more frequently (50%) than MCP-1-2518 AA homozygous individuals (33%, p=0.04) (Figure 2)  no association between the presence of MCP-1-2518 alleles/genotypes in donors and development of aGVHD was found

9. Table 1: Genotype and allele frequencies of the MCP-1-2518 A/G SNP in the groups of patients with/without aGVHD Patients aGVHD+Patients aGVHD- Genotype frequency n= 52 n= 80 Genotype AA0.50 (26)0.68 (54) Genotype GA0.44 (23)0.31 (25) Genotype GG0.06 (3)0.01 (1) Allele frequencyn= 104n= 160 Allele A0.72 (75)0.83 (133) Allele G0.28 (29)0.17 (27)p = 0.03

10. Figure 1: MCP-1-2518*G allele frequency in patients according to the presence/absence of acute GVHD p = 0.03

11. Figure 2: Occurence of acute GVHD in carriers/non-carriers of MCP-1-2518*G allele p = 0.04

12. CONCLUSION Our study revealed association between MCP-1-2518*G allele in recipients and aGVHD in Czech and Slovenian patients after aHSCT. This data suggest that MCP-1-2518 gene polymorphism may contribute to the development of acute GVHD at least in West-Slavonic populations. Replication on further cohorts / populations and data on MCP-1 expression in aGVHD may clarify real contribution of the MCP-1-2518 variants to the development of GVHD.

13. REFERENCES Arakelyan A, Petrkova J, Hermanova Z, Boyajyan A, Lukl J, Petrek M: Serum levels of the MCP-1 chemokine in patients with ischemic stroke and myocardial infarction. Mediators Inflamm 2005;3:175-9 Lacha J, Hribova P, Kotsch K, Brabcova I, Bartosova K. Volk HD, Vitko S: Effect of cytokines and chemokines (TGF-beta, TNF-alpha, IL-6, IL-10, MCP-1, RANTES) gene polymorphisms in kidney recipients on posttransplantation outcome: influence of donor-recipient match. Transplant Proc 2005; 37: 764-6 Petrek M, Kolek V, Szotkowska J, du Bois RM: CC and C chemokine expression in pulmonary sarcoidosis. Eur Respir J 2002; 20: 1206-12 Rovin BH, Lu L, Saxena R: A novel polymorphism in the MCP-1 gene regulatory region that influences MCP-1 expression. Biochem Biophys Res Commun 1999; 259: 344-8 Schröppel B, Fischereder M, Lin M, Marder B, Schiano T, Krämer BK, Murphy B: Analysis of gene polymorphisms in the regulatory region of MCP-1, RANTES and CCR5 in liver transplant recipients. J Clin Immunol 2002; 22: 381-5 Wysocki CA, Panoskaltsis-Mortari A, Blazar BR, Serody JS: Leukocyte migration and graft-versus-host disease. Blood 2005; 105: 4191-9